Totale Masken-Macht im Söder-Land

Markus Söder, der Bayern-Fürst, führt ein strammes Corona-Regime. Er will auf Nummer sicher gehen und das „hochgefährliche“ Corona-Virus bezwingen, das in seinem Land wieder zunehmend getestet wird. Das Volk der Bayern muss sich strengen Maßnahmen unterwerfen, insbesondere gibt es bei Verstößen gegen die Maskenpflicht im öffentlichen Nahverkehr, in Geschäften und Gaststätten kein Pardon, sondern harte Bußgelder. Auch angesichts ganz anderer wissenschaftlicher Erkenntnisse als die der bundesdeutschen Hofvirologen fechten den forschen Franken keinerlei Zweifel an. Er „spürt es“ und es ist für ihn „definitiv klar“: „Corona ist da, Corona bleibt da.“

Urlaubs-Impressionen

Urlaub in Bayern. Das neunte Jahr machten wir Urlaub im Allgäu, zum siebten Mal in derselben Ferienwohnung mit wunderbarem Blick auf den Kranz der Berge, der unseren Urlaubsort umgibt. Wir lieben die vielen Seen, die man auch im Alter noch mit herrlichen Ausblicken bequem umwandern kann, um anschließend auf der Terrasse eines der vorzüglichen Gasthöfe oder einer ausgezeichneten Pizzeria zu essen. Und wir schätzen die italienischen Eiskaffees am Ort, die sich um das köstlichste Eis in ständigem Wettbewerb befinden. – Doch dieses Jahr war alles anders.

Der Masken-Wahn liegt schwer auf dem Land und drückt die Stimmung der Einheimischen und Touristen. Noch muss man die Corona-Maske nicht auf der Straße tragen, aber ohne Maske wird man in kein Geschäft zum Einkaufen gelassen, und selbst die völlig freie Terrasse eines Restaurants oder den Biergarten eines Gasthofes ohne Maske zu betreten, ist schier unmöglich. Sperren zwingen den Gast, am Eingang stehen zu bleiben, bis eine Bedienung kommt, die ihn nur unter der Bedingung, dass er eine Maske aufsetzt, zu einem freien Tisch geleitet. Und erst wenn er Platz genommen hat, darf er die Maske abnehmen.

Konnte man in Baden-Württemberg noch maskenfrei einkaufen, ohne dass sich jemand daran störte, – im Mai hatte ich manchmal auf mein ärztliches Attest verweisen müssen -, und konnte man die Restaurants inzwischen sogar erlaubterweise unmaskiert betreten, in Bayern ist das (nahezu) ausgeschlossen. Am ersten Tag, an dem wir essen gingen, hatten wir noch Glück. Ein älterer, gewitzter Ober führte uns lächelnd zu einem Tisch, ohne auch nur einen Blick auf meine nicht vorhandene Maske zu werfen. Am nächsten Tag betraten wir die noch fast leere Terrasse einer Pizzeria wie in den Jahren zuvor von der hinteren Seite und setzten uns ungehindert an einen Tisch, um dann von einem aufgeregten jungen Kellner belehrt zu werden, dass wir nur von vorne mit Maske die Terrasse hätten betreten dürfen, die wir auch später dort wieder mit Maske verlassen müssten. Es drohten ihnen hohe Busgelder, wenn sie das nicht durchsetzten, und sie würden häufig streng überwacht. – Wir haben nach der ausgezeichneten Pizza die Terrasse dann doch nach hinten (wo kein Mensch saß) unmaskiert verlassen.

Die kleine Terrasse unseres beliebten italienischen Eiskaffees war kaum besetzt. Es brauchte nur drei Schritte zum nächsten freien Tisch, ohne jemand dabei nahe zu kommen. Aber der aufgeregt gestikulierende Chef bestand hartnäckig auf der Maske, da er sonst hohe Strafe bekomme. Er würde von der Behörde streng kontrolliert. Ich bestand darauf, diesen Unsinn nicht mitzumachen, ich hätte auch ein ärztliches Attest. Das lasse er nicht gelten, erwiderte er, er könne nicht beurteilen, ob es echt sei. Schließlich schlug er einen Kompromiss vor und reichte mir eine Serviette, die ich die drei Schritte gleichsam wie zum Schnäuzen vor Nase und Mund hielt. Beim Weggehen wischte ich mir damit jedoch nur noch die köstlichen Eis-Reste von den Lippen, wie es sich gehört.

Wenigstens auf dem Minigolfplatz keine Maske – so dachten wir. Doch von ferne fiel uns schon auf, dass gegen früher am Spätnachmittag nur wenige Leute auf dem an sich sehr beliebten Platz waren, auf dem der Inhaber die Gäste immer wieder mit ausgetüftelten technischen Gags überrascht. Am Eingang musste man stehen bleiben, durfte nur auf Aufforderung zum Schalter kommen und zwar mit Maske, die wieder abzunehmen erst nach Absolvierung der ersten Bahn erlaubt war. Uns verschlug es den Atem, und wir wendeten uns ab mit Grausen. – Später erfuhren wir vom Inhaber eines anderen Minigolfplatzes, an dem wir beim Wandern vorbeikamen, dass Behördenvertreter auf jedem Minigolfplatz festlegen, ob und in welchem Ausmaß eine Maskenpflicht im Eingangsbereich zu gelten habe.

Wie schon bei der Eisdiele erlebt, werden von den Geschäften keine ärztlichen Atteste akzeptiert, seit der Bayerische Rundfunk und die Polizei vor ausgedruckten Blanco-Attesten von Ärzten aus dem Internet warnten. Manche trauen sich zu, sie von „echten“ Attesten zu unterscheiden, andere wie der größte Supermarkt am Ort schreiben außen groß an, dass ärztliche Atteste grundsätzlich nicht anerkannt werden. Das widerspricht natürlich der bayerischen Corona-Verordnung, wonach Personen mit gesundheitlichen Behinderungen keine Masken tragen müssen, wenn sie dies glaubhaft machen. Wie soll man es anders glaubhaft machen als mit einem ärztlichen Attest. Kranke müssen sich also auf eine harte rechtliche Auseinandersetzung mit den Geschäften gefasst machen, wenn sie überhaupt einkaufen und am Leben bleiben wollen.

In der Söder-Mark besteht eine von oben bis in die untersten Behörden straff organisierte Überwachung der Maskenpflicht. Das hat natürlich der Denunziation durch fanatisierte Panik-Untertanen oder übelwollende „Freunde“, die dem anderen schon immer mal gerne eins auswischen wollten, Tür und Tor geöffnet. In diesem gnadenlosen söderschen Maskenregime herrscht genauso viel Angst vor Denunziation und Bußgeldern  wie vor Corona. – Eine gespenstische, surreale Atmosphäre – Vorgeschmack auf die orwellsche Zukunft.

Söders Panik-Mache

Wegen steigender Infektionszahlen besonders in Bayern, rief Markus Söder am 10.8.2020 seine Minister zu einer Sondersitzung zusammen und trat anschließend vor die Presse: „Corona macht keine Ferien. … Eine Pandemie ist ein mutierender Prozess. Man muss immer wieder alle zwei Wochen nachjustieren. … Wir spüren, dass Corona nach wie vor präsent ist. … Corona wird jeden Tag gefährlicher. Es werden zunehmend die Spätfolgen langsam sichtbar. Es gibt sehr viele Berichte von Menschen, die bis heute darunter klagen, dass, obwohl die Infektion seit Monaten her war, sie nach wie vor erhebliche Belastungen haben: fehlender Geruchssinn, möglicherweise das Lungenvolumen nicht zurückgekehrt ist; und viele medizinische Studien berichten zunehmend von Spätfolgen, die einen lange beschäftigen können.
Deswegen ist mittlerweile klar, dass Corona viel heimtückischer und gefährlicher ist, als bisher angenommen und dazu, wenn man eine Infektion überstanden hat, leider noch mit Spätfolgen zu rechnen ist. Umso wichtiger ist es, deswegen nicht mit Leichtsinn, sondern mit Umsicht weiter zu reagieren. Wir spüren, dass in ganz Europa Corona auf dem Vormarsch ist und leider auch bei uns wieder sehr stark. Ob man es zweite Welle nennt oder nicht: Definitiv ist für mich klar: Corona ist da, Corona bleibt da, und Corona wird wieder deutlich stärker werden.“

Söder spielt hier medienwirksam eine Sicherheit des Wissens vor, die er gar nicht haben kann. Es ist purer Glaube, der sich staatstragend aufplustert; – oder politische Täuschungsabsichten verbirgt? Es gibt in der Realität keine Pandemie, und es hat auch von Anfang an keine Krankheits-Ausbreitung gegeben, die diesen Namen verdient hätte. „Eine Pandemie, die Menschen in diesem Jahr vermehrt erkranken lässt, findet schlicht nicht statt“, stellt der erfahrene Amtsarzt Dr. Wolfgang Wodarg fest. Was Söder zu „spüren“ meint, ist nicht die Krankheit, sondern die positiven Tests, die er wider besseres Wissen mit der Krankheit gleichsetzt. Die Corona-Krankheit wird nicht „jeden Tag gefährlicher“. Wo bleiben die Infizierten oder gar Kranken der maskenlosen Groß-Demos zu „Black-Lifes-matter“ und vom 1. August 2020 in Berlin? Seit Wochen gibt es keine neuen Corona-Kranken mehr, wie selbst das RKI feststellen muss.
Deutschlandweit liegen, mit abnehmender Tendenz, insgesamt nur noch 228 Corona-Kranke (19.8.2020) auf den Intensivstationen, in Bayern sollen es gerade 24 sein. Die Gefährlichkeit einer Krankheit kann nur an der Zahl schwerer Erkrankungen und der Todesfälle gemessen werden.

Nach der Erfahrung vieler Mediziner und Forscher werden ca. 80 %  der Infizierten überhaupt nicht krank oder haben nur geringe Symptome. Die Corona-Infektion, so der Immunologe Prof. Hockertz, „ist gefährlich für etwa 5% der Bevölkerung: alte, kranke, schwache Menschen, vorgeschädigte Menschen, Raucher, also all die Menschen, deren Lunge vorgeschädigt ist. … Also 5% der Menschen sind wirklich gefährdet, diese Krankheit auszubilden. Ich spreche noch nicht von Toten, ich spreche nur davon, die Krankheit auszubilden, also Atemwegserkrankungen bis hin zu Lungenentzündungen. 95% aller Menschen machen diese Krankheit leicht durch oder haben gar keine Symptome.“
Von einer allgemeinen hohen Gefährlichkeit der Corona-Krankheit, die jeden erfassen könne, kann also absolut keine Rede sein. Das wird aber von Söder im Verein mit der gesamten politischen Klasse in Deutschland ständig suggeriert.

Söder begründet die totalitären Maßnahmen des Staates, durch die die Grundrechte der ganzen Bevölkerung massiv eingeschränkt werden, mit den schweren Erkrankungen verhältnismäßig weniger und deren möglichen Spätfolgen, die er angstmachend dramatisiert. Das steht in keinem Verhältnis zueinander. Als Jurist müsste er wissen, dass der fundamentale verfassungsrechtliche Grundsatz der Verhältnismäßigkeit dies nicht zulässt. Der renommierte Verfassungsrechtler Prof. Dieter Murswiek hat dazu schon früh Stellung genommen, siehe hier. Söder handelt – wie die Bundesregierung – eklatant verfassungswidrig.

Bayerns Regierung betreibt unter der Vorspiegelung, schon die Infektion sei für jedermann gefährlich, eine Testorgie, die eine Scheindynamik an Infektionen erzeugt und der Angst- und Panikmache dient. Und Angst macht gefügig, wie der Blick auf das derzeitige Verhalten der einstmals selbstbewussten Bajuwaren zeigt. Der Anstieg der Infizierten ist in der Hauptsache das Ergebnis enorm gestiegener Tests. Söder hebt selbst in der Pressekonferenz stolz sein Bemühen hervor, die Tests kontinuierlich auszuweiten. Ende Mai habe es in Bayern 22.000 Tests täglich gegeben, Anfang August habe man schon 55.000 pro Tag einsetzen können, und Ende August sollen 200.000 Tests pro Tag erreicht werden. Das ist doch klar: Je mehr Tests, desto mehr positive Ergebnisse, ein Zusammenhang, der aber bei der täglichen Meldung der Infektionszahlen verschwiegen wird.
Hinzu kommt, dass die Fehlerquote der Tests nach Prof. Bhagdi bei ca. 2% liegt. D.h. wenn täglich in Deutschland 100.000 Menschen getestet werden, sind 2.000 Ergebnisse falsch. Da die täglich positiv Getesteten darunter liegen, ist diese Zahl vollkommen unzuverlässig, im Extremfall können sie alle falsch sein.

Die PCR-Tests

Die Problematik dieser Testorgie steigt ins Absurde, wenn man dahinter kommt, dass diese PCR-Tests überhaupt keine Viren direkt nachweisen, sondern kleine Partikel aufspüren, die von einem Virus abstammen sollen und dieses angeblich indirekt nachweisen. Es gibt aber einen solchen Nachweis nicht, denn diese Partikel können ebenso körpereigene sein als Reaktion auf irgendwelche Belastungen. Dies wird auch von vielen Wissenschaftlern so gesehen. So fassen Torsten Engelbrecht und Claus Köhnlein in ihrem Buch „Virus-Wahn“ deren Erkenntnisse so zusammen: Die PCR-Tests werden dazu genutzt, „genetische Sequenzen, also kleine genetische Schnipsel (Nukleinsäuren), aufzuspüren und dann millionenfach oder milliardenfach zu vermehren. Wie beim Antikörper-Test, so hat auch die PCR wahrscheinlich ihre Bedeutung darin, dass sie eine Art von – wie es in der Fachsprache heißt – Immunreaktion des Körpers anzeigt, oder, um es neutraler zu formulieren: irgendeine Art Störung oder Aktivität auf Zellebene.“
Entsprechend äußerte sich auch die Virologin und Immunologin Prof. Ulrike Kämmerer von der Uni Würzburg ausführlich im Rahmen der Stiftung Corona Ausschuss in der Sitzung vom 24. Juli 2020. Zusammengefasst: „Der PCR-Test zeigt nur die Nukleinsäuren an, nicht das Virus, er kann keine Infektion nachweisen. Der PCR-Test kann nicht nachweisen, ob das Virus replikationsfähig ist, sich in dem Wirt tatsächlich vermehrt und ob der Mensch damit ursächlich krank wird. Wenn beim PCR-Test auf der Oberfläche des Abstrichs dies Virus RNA ist, heißt das noch nicht, dass es in den Zellen drin ist und ob eine intakte vermehrungsfähige Viruslast vorhanden ist.“
Für einen Zusammenhang mit einem Virus gibt es also keinen Beweis, sondern nur Spekulationen. (Vgl. auch: Annahmen, Schätzungen, Glaube …)

Bisher kein Virus-Nachweis

Engelbrecht/Köhnlein gehen im Rahmen ihres Buches noch weiter. Sie konstatieren, dass es einen Zusammenhang mit einem Virus auch gar nicht geben könne, denn „ … noch nie wurde – was der konsequenteste und sauberste Nachweis wäre – Patientenblut genommen und direkt daraus eines dieser Viren mit ganzer Erbsubstanz (=Genom) und Virushülle in gereinigter Form isoliert und anschließend elektromikroskopisch aufgenommen: nicht H5H1 (Vogelgrippe), nicht das sogenannte Hepatitis-C-Virus, nicht HIV und auch viele andere Partikel nicht, die offiziell Viren genannt und als angriffslustige Biester dargestellt werden.“

Die Autoren haben im Sommer 2005 das Robert-Koch-Institut gebeten, ihnen 1. Studien zu nennen, die einwandfrei belegen, dass die verschiedenen Viren nachgewiesen wurden (vollständige Reinigung, Isolierung und Bestimmung der biochemischen Eigenschaften plus elektronenmikroskopische Aufnahme); 2. Studien zu nennen, die einwandfrei belegen, dass die nach (1) nachgewiesenen Viren krankmachend sind (und auch nicht andere Faktoren wie Mangelernährung, Giftstoffe etc. den Krankheitsverlauf zumindest mitbestimmen).
Trotz mehrfacher Nachfragen ist ihnen bis heute keine Studie genannt worden.
Auch in Bezug auf das Corona-Virus liegt eine solche Studie nicht vor.

Daher kann auch ein PCR-Test nicht einen Zusammenhang mit einem Virus nachweisen, dessen Charakteristika nicht zuvor bestimmt worden sind. (Siehe genauer: „Die Wissenschaft vom Virus …“)

Resümee

Vor diesem Hintergrund tun sich noch ganz andere Dimensionen auf. Wenn es gar kein nachgewiesenes Corona-Virus gibt, das sich von außen krachmachend und tötend auf die Menschen stürzt, sind die Tests eine einzige gigantische Irreführung. Es wird den Menschen etwas vorgetäuscht, das überhaupt nicht existiert, ob das die Virus-Jäger jeweils selber wissen oder nicht.
Die Corona-Krankheit gibt es natürlich, aber sie muss ganz andere Ursachen haben, nach denen man nur nicht forscht, weil man einem eingebildeten Erreger nachjagt, einem Phantom, das offenbar nur in der Phantasie einiger Virologen existiert, die den Boden exakter Wissenschaft längst verlassen haben.

Das Tragen der Masken ist schon unter der Voraussetzung, dass es Viren gäbe, ein Unsinn. „Die Maske schützt wissenschaftlich, aufgrund der höchsten Evidenzstufen nicht gegen den Virus.“ (Dr. med. Walter Weber hier.) So heißt es auch auf der Seite des Bundesinstituts für Arzneimittel und Medizinprodukte (BfArM) zur Alltagsmaske: „Träger der beschriebenen Mund-Nasen-Bedeckungen können sich nicht darauf verlassen, dass diese sie oder andere vor einer Übertragung von SARS-CoV-2 schützen, da für diese Masken keine entsprechende Schutzwirkung nachgewiesen wurde.“ (s. hier) Entsprechend äußerte sich die niederländische Gesundheitsministerin Tamara van Ark: „Aus medizinischer Sicht gibt es keinerlei Beweis für den medizinischen Nutzen, eine Gesichtsmaske zu tragen. Daher haben wir uns dafür entschieden, auf nationaler Ebene keine Maskenpflicht einzuführen“ (hier).

Angesichts der Meinung, dass das Virus so klein sei, dass es sich im Millionstel  Zentimeterbereich bewege und nur mit einem Elektronenmikroskop erfasst werden könne, vergleichen manche die Gesichtsmaske mit einem Maschenzaun, der Fliegen abhalten soll.
Der renommierte Epidemiologe Prof. Bhagdi sagte kürzlich in dem bereits oben verlinkten Interview, wie MMnews zusammenfast: „Das Tragen von Masken habe kaum nachgewiesene positive Effekte, dafür aber viele bekannte negative (CO2-Anteil im Blut steigt). Die Maskenpflicht an Schulen sei Kindesmisshandlung und auch Misshandlung von älteren Menschen. Bhakdi ruft die Lehrer auf, sich dagegen zu wehren. Die Zahlen der Erkältungen durch Rhinoviren seien so stark angewachsen wie noch nie – nicht trotz, sondern wegen der Maskenpflicht.“

Wenn es aber überhaupt kein Virus gibt, offenbart sich das Tragen der Masken erst recht als ein gewaltiger Mumpitz, ein absurdes Theater, das bei späteren  Zuschauern tosendes Gelächter auslösen muss – wenn es nicht so ernst wäre. Denn die gesundheitlichen, sozialen, pädagogischen und wirtschaftlichen Schäden, die mit dieser und den anderen staatlichen restriktiven Maßnahmen herbeigeführt werden, lassen das Ganze nicht nur surreal, sondern tief tragisch erscheinen. Wer sind die Autoren und Regisseure dieses Stückes?

Die Maske erfüllt nur die Funktion eines Unterwerfungssymbols, das die Angst vor dem imaginären Virus aufrechterhalten soll, bis der Impfstoff der profitsüchtigen Pharmaindustrie da ist. –
Wir befinden uns bereits in einer totalen Corona-Diktatur – ein Vorgeschmack auf den Totalitarismus.

130 Kommentare zu „Totale Masken-Macht im Söder-Land“

  1. Es sind an corona mehr verblödet als gestorben !

    C. wurde schon 2019 klar geplant /verwendet , um die seit Jahren anstehende Finanz & Wirtschafts Krise
    / an der alle Politiker mit Schuld tragen/ zu Rechtfertigen !
    wer seit Wochen den Wirtschaft Seiten seiner Zeitung liest , wird inzwischen täglich den Satz lesen _
    – die Corona Wirtschaftskrise usw. –

    cui bono

    1. «Er [Söder} will auf Nummer sicher gehen und das „hochgefährliche“ Corona-Virus bezwingen, das in seinem Land wieder zunehmend getestet wird. «

      Das würde ich als Falschaussage bezeichnen. Söder ist der hochgefährliche Coronavirus völlig egal, der ist nämlich schon längst verändert und hat keinerlei Auswirkungen mehr. Das sagen die Fachleute und nicht inkompetente Politiker und abschreibende Journalisten. Das sagen auch die vorgelegten Charts und Kurven über die Corona-Grippe-Welle in allen Ländern, die schon längst abgeflaut ist. Eine zweite Welle gibt es nicht.

      Söder kann aber an diesem Thema seinen internationalen Vorgesetzten schön zeigen, wie servil er ihnen gegenüber ist und dass er für eine entsprechende politische – für die Mächtigen hilfreiche – Machtposition bereitsteht. Ob er dafür schon auf der Lohnliste der genannten Vorgesetzten ist, weiss die Öffentlichkeit nicht, aber man kann sich kaum des Eindrucks erwehren, dass es schon eine ganze Weile so ist. Auf jeden Fall wurden eine Menge Regierungen auf der Welt bzgl. Corona von diesen Mächtigen geschmiert. Die angebliche Corona-Pandemie ist also nichts anderes als eine der übelsten Schmierenkomödien, die die Welt bis heute gesehen hat.

      Corona – die gekaufte Pandemie
      https://www.anderweltonline.com/klartext/klartext-20202/corona-die-gekaufte-pandemie/

      1. Söder hats Oktoberfest gecancelt…das sind Millionengewinne der Wirte,dieNICHT erzielt werden! Wenn er jetzt sein Versagen zugibt ist er TOT !

  2. Wieder mal ein sehr schön zusammengefasster Artikel! Bitte noch den Namen von Prof. Bhakdi korrigieren, er schreibt sich nicht Baghdi, sondern Bhakdi.

  3. Juni 2005, Merkel betont:
    Deutschland hat keinen Rechtsanspruch auf Demokratie und sozialer Marktwirtschaft für alle Ewigkeit….

    2020
    Die Maskenpflicht und alle damit zusammenhängenden Maßnahmen sind für mich Ausdruck des „demokratischen Faschismus“, die dritte Form des Faschismus nach Nazi-Faschismus und Kommunisten-Faschismus.
    Wer den Bürgern die Medizin befiehlt, die Grundrechte raubt und rein propagandistisch agiert, hat die Wege der Freiheit bereits verlassen.
    Die Masse der verängstigen Bürger kann die Freiheit nicht verteidigen – aus Angst vor finanzieller Repression.

    Dieser politische Wahnsinn toppt all jene Politiker, die dem Caesaren-Wahn über Jahrtausende anheim gefallen sind.

    Merkel, Söder und all die anderen , die ganze Völker fremdbestimmen wollen, können diesen Krieg (und es ist ein Krieg gegen die Freiheit eines jeden Einzelnen) nicht gewinnen – es sei denn, sie erschießen die eigene Bevölkerung.

    1. @Adept: „Merkel betont: Deutschland hat keinen Rechtsanspruch auf Demokratie und sozialer Marktwirtschaft für alle Ewigkeit….“

      Ich betone: Merkel hat von Ewigkeit so wenig Ahnung bzw. Wissen, wie sie Wissen bzw. Ahnung vom Erziehen eigener Kinder hat.

      1. @Michael: Ja, woher auch- sie ist nicht einmal von einer Ahnung getrübt- während ihre Anmaßung grenzen- und alternativlos ist, getrieben von dunklen HinterMächten…

        „Eine jede Kreatur wirkt ihr Werk um eines Zweckes willen. Der Zweck ist jederzeit das erste in der Meinung und das letzte im Werke.“ Meister Eckhart, Predigten

        Wörtlich genommen kann das auch die vielen Wahllügen und Wahlversprechen, die sich dann regelmäßig als „madig“ erweisen, erklären.

        Er (der Zweck) ist aber oftmals (v.a. bei Berufs-Politikern) auch gut versteckt das letzte, was man erkennen kann- quasi die späte madige „FRUCHT“ aus den übervielen Wortblüten und Sprachgetüftel….über Demokratie und westliche WerteGemeinschaft- heuer mit Maulbinde als „Zügel“ für die Herde der „Langgeohrten und Kurzgeäutgen“….

      2. @Michael

        „Merkel hat von Ewigkeit so wenig Ahnung bzw. Wissen, wie sie Wissen bzw. Ahnung vom Erziehen eigener Kinder hat.“

        Wen wundert’s – sie hat ja keine Kinder – meines Wissens weder selbstgeborene noch von ihr adoptierte Kinder.

        Und da isses wohl wie mit dem Geld der anderen, das die S.z.n jeglicher Couleur offenbar so gerne anderen abnehmen, um es dann mit vollen Händen ‚rauszuwerfen und/oder in die eigenen Taschen zu stopfen.

        Mit den Kindern anderer meinen sie eben auch machen zu können was sie wollen.

  4. Dieses „Neue Normale“ was da beschrieben wird, ist ohne Zweifel eine pathologisch-totalitäre Ideologie. Und diese wird systematisch verbreitet. Vermutlich hat dieses ideologisches Programm nur noch wenig, mit einem tatsächlichen Virus, oder einer anderen tatsächlichen Bedrohung der öffentlichen Gesundheit zu tun. Es scheint, dass dieses „Pseudo=Pandemie“ immer mehr zu einem trojanisches Pferd wird, ein Mittel zur Einführung einer „neuen Normalität“…….

    In dieser neuen „Normal-Gesellschaft“, die da erstellt wird, sind Angst und Konformität allgegenwärtig. Die Angst vor Krankheit, Infektion und Tod sowie die obsessive Beachtung von Gesundheitsfragen werden jeden Aspekt des Lebens dominieren. Paranoide Propaganda und ideologische Konditionierung werden allgegenwärtig und konstant sein.

  5. Lieber Herr Ludwig, vielen Dank für diesen Bericht und die nachfolgende Faktenlage! Stelle ich mir eine Sommer-frische früherer Tage noch sehr erholsam vor, so erinnern Ihre Schilderungen eher an einen Freigang mit Fußfessel. König Ludwig, ehemals Schöngeist mit hohen idealistischen und politischen Zielen, dreht sich im Grabe um, angesichts eines Barbaren, der nun in höchste Ämter vorgerückt ist, um die gesamte Bevölkerung zu tyrannisieren.

    Bei dem Gedanken, ob es bei den derzeitigen Massentests überhaupt mit rechten Dingen zugeht, bin ich auf folgendes gestoßen:

    “Die Entnahme der Körperzellen darf ohne schriftliche Einwilligung des Beschuldigten nur durch das Gericht, bei Gefahr im Verzug auch durch die Staatsanwaltschaft und ihre Ermittlungspersonen (§ 152 des Gerichtsverfassungs-gesetzes) angeordnet werden.”

    https://dejure.org/gesetze/StPO/81g.html

    Dr. Jaroslav Belsky fragt: “Geht es tatsächlich um eine Virus Diagnostik, oder um die Erstellung einer Gen-Karte?” –

    Hinzu kommt, dass Jens Spahn bereits im Januar den Beitritt zum Genomprojekt der EU unterschrieb:

    “…Bundesgesundheitsminister Jens Spahn unterzeichneten heute in Berlin gemeinsam die Deklaration „Towards access of at least 1 million sequenced Genomes in the EU by 2022“. Ziel der Initiative ist es, länderübergreifend einen sichereren und geregelten Zugang zu mindestens einer Million kompletter Genomsequenzen und weiterer Gesundheitsdaten zu ermöglichen…”

    https://www.bmbf.de/de/deutschland-tritt-genomprojekt-der-eu-bei-10676.html

  6. ZITAT @ Herbert Ludwig:
    „Söder handelt – wie die Bundesregierung – eklatant verfassungswidrig.“

    Schon vor Monaten – als die vielen LÜGEN rund um Corona an’s Licht drängten – wunderten wir uns über die scheinbare, totale ABWESENHEIT der deutschen Justiz, und das scheinbare FEHLEN deutscher Juristen . . .
    Tatsächlich war das aber der im TOTALITARISMUS üblichen UNTERDRÜCKUNG aller wichtigen Informationen durch die Regierung & durch die von Regierungen „gekauften Journalisten“ (copyright: Dr. Udo Ulfkotte), also durch brutale & totale ZENSUR geschuldet!
    HIER also im O-Ton Dr. Reiner Füllmich – seit 26 Jahren in Deutschland & in California/USA zugelassener Anwalt aus Göttingen – als Anlaufstelle für ALLE Unternehmer & Sedlbstständigen – denen durch den Corona-Terror der Regierung(en) ein VERDIENST-AUSFALL oder anderer SCHADEN entstanden ist, mit 4 logisch aufgebauten Weltklasse-Videos aus dem Monat Mai:
    https://www.fuellmich.com/urteile/youtube-kanal-dr-fuellmich/

    WER wissen will – WOHIN die Reise geht – der mag mit dem letzten Video von Dr. Reiner Füllmich beginnen:

    Titel:
    „Das wohl wichtigste VIDEO in unserer ZEIT – HEUTE und MORGEN… UNBEDINGT ANSEHEN!!!!“

    1. @KBM

      Ich habe alle Teile des Corona-Ausschusses gesehen. Mir dauert das alles viel zu lange. Es wird palavert, es wird spekuliert, es wird verschoben. Aber die Zeit ist die wichtigste

      Man hätte eine Normenkontrollverfahren parallel anstrengen sollen, so wie es jetzt Jessica Hamed getan hat. Denn die Vorgaben kollidieren mit geltendem höher stehendem Recht. Skandalös ist die bestätigte Tatsache, dass zu den einsamen Söder-Entscheidungen in Bayern keinerlei Akten in den Ministerien existieren, weder von Beratern, noch von Sitzungen:

      https://multipolar-magazin.de/artikel/corona-vor-gericht

      Die Verordnungen/Regeln aller 16 Bundesländer kollidieren mit geltenden höher stehenden Arbeitsschutz-Gesetzen und müssen vom BVerwG gekippt werden. Das lässt sich mit Eilantrag realisieren. Danach hätte man Zeit, die gesamte Thematik nach dem von Ihnen verlinkten Video aufzuarbeiten.

      Wenn die nach der Trump-Wahl damit anfangen, sind alle Akten verschwunden und man hat nach bestem Wissen und Gewissen gehandelt. Frau Hamed vertritt einen klagenden Richter aus Thüringen:

      https://multipolar-magazin.de/artikel/corona-vor-gericht

      1. Geht mir genauso mit dem Corona-Ausschuß, anfangs fand ich den toll, da hieß es aber auch, die sind Anfang August fertig mit den Untersuchungen, heute haben wir den 20.8. und die palavern immer noch. Wollen die nicht fertig werden? Wozu noch die Rederei, alles ist klar, wie Kloßbrühe und die Zeit ist das Wichtigste, richtig erkannt.
        Denn das System macht immer weiter, während wir nur palavern. Wann werden endlich juristische Fakten geschaffen?
        Oder gibt es keine Juristerei mehr in Deutschland? Wie lange noch dürfen irgendwelche Politkasper a la Söder in Deutschland schalten und walten, wie sie wollen?

        1. @teutoburgswaelder: „Denn das System macht immer weiter, während wir nur palavern….“
          Das sehe ich genau so !!!
          Während „die“ palavern, sind eben die kritischeren Zeitgenossen wunderbar abgelenkt und schwelgen in der Illusion, es passiere demnächst etwas … was auch immer.
          Ich frage mich: Was wird zwischenzeitig mit 5G arrangiert…???
          Es gibt nur wenige Stimmen in der Öffentlichkeit, die sich auf 5G konzentrieren.
          Die Rechtswege sind blockiert – gut hierarchisiert – weiter oben in der Hierarchie nur noch Marionetten in Sicht.

      2. @ Hubi Stendahl:

        „Wenn die nach der Trump-Wahl damit anfangen, sind alle Akten verschwunden und man hat nach bestem Wissen und Gewissen gehandelt.“

        Das könnte sich auch bis zum Krieg „hochschaukeln“. Nach meinem Dafürhalten gibt es mindestens zwei globale Seiten privater Natur, die sich hier gegenseitig bekriegen und über die wir nur wenig gesicherte Information haben. Und ein lachender globaler Dritter ist natürlich auch dabei.

        1. @ Herr Schütze:

          „Nach meinem Dafürhalten gibt es mindestens zwei globale Seiten privater Natur, die sich hier gegenseitig bekriegen und über die wir nur wenig gesicherte Information haben. Und ein lachender globaler Dritter ist natürlich auch dabei.“

          Und wer oder was sind diese drei? Ich nehme an, Sie meinen mit der einen Seite die, zu der Trump zu zählen sind, und mit der anderen Seite die Gegner Trumps. Ihr „lachender globaler Dritter“ kann doch dann nur die Hochfinanz sein. Ist das richtig, Herr Schütze?

          Trump scheint gegen die Impfmafia zu sein, unternimmt aber selbst Versuche in die Richtung, die in die Impfung führen. Die Gegner Trumps sind eindeutig auf der Seite von Soros und Gates (Linksrassismus/Antifa/Antihumanismus/Dysgenik). Aber ist diese Zweiseitigkeit in Wirklichkeit keine Zwistigkeit oder gar Feindschaft, sondern nur eine Inszenierung?

        2. @ Kathrina (oder heißen Sie nicht Kathrina, sondern Katharina?): „@ Herr Schütze: »Nach meinem Dafürhalten gibt es mindestens zwei globale Seiten privater Natur, die sich hier gegenseitig bekriegen und über die wir nur wenig gesicherte Information haben. Und ein lachender globaler Dritter ist natürlich auch dabei.«

          Und wer oder was sind diese drei? Ich nehme an, Sie meinen mit der einen Seite die, zu der Trump zu zählen ist, und mit der anderen Seite die Gegner Trumps. Ihr „lachender globaler Dritter“ kann doch dann nur die Hochfinanz sein. Ist das richtig, Herr Schütze?

          Trump scheint gegen die Impfmafia zu sein, unternimmt aber auch selbst politische Versuche in Richtung Impfung. Die Gegner Trumps sind eindeutig auf der Seite von Soros und Gates (Linksrassismus / Antifa / Antihumanismus / Dysgenik). Aber ist diese Zweiseitigkeit in Wirklichkeit keine Zwistigkeit oder gar Feindschaft, sondern nur eine Inszenierung?“

          Vielleicht ist es so, vielleicht ist es aber auch nicht so. Ich weiß es auch nicht genau. Hier kann man eigentlich nur spekulieren, weil ja nichts nach außen dringt. Esoterik, Geheimhaltung bis hin zur Verschwörung. Wie soll man darüber etwas ganz genau wissen können?

      3. ZITAT @ Hubi Stendahl:
        „Ich habe alle Teile des Corona-Ausschusses gesehen. Mir dauert das alles viel zu lange. Es wird palavert, es wird spekuliert, es wird verschoben. . .“

        Die Zeit habe ich mir zum Beispiel gespart!

        Ich vertraue aus langer Erfahrung KEINEM fremden Ausschuss – ich mache EIGENE Investigationen – dort untersuche ich nur diejenigen Dinge, die ich komplett VERSTEHE & DESHALB auch OHNE Fehler, jede Art von BETRUG und/oder LÜGE darin erkenne!

        DARÜBER berichte ich.

        Da ich mich seit dem 19. Juli 1963 auf die Ursache von Selbstmord konzentriert & spezialisiert habe – und diese Ursache, nach ewiger Suche, NICHT im Körper des Menschen fand, sondern im MENTALEN Bereich des Lebens – werden Depressionen von daher auch, durch die angeblich „moderne“ Schulmedizin, zur Zeit weder VERSTANDEN, noch geheilt!

        DAS BEWEISEN die globalen Statistiken zu diesem Thema – der auf das rein „materielle“ Universum begrenzten Schulmedizin, schwimmen die Felle davon – und so driftet diese, zunehmend in ihrer Kern-Kompetenz versagende, weil halbseitig „blinde“ & inkompetente Medizin, seit Jahrzehnten immer tiefer in den kriminellen Polit-Totalitarismus!

        DAS ist mein Thema – und der medi-zynische Corona-Krieg ist nur der neueste Schwachsinn – in einer langen Kette der Verwirrungen durch diese grundlegende Verirrung der angeblich „modernen“ Medizin . . .

        Bitte seien Sie so höflich, und akzeptieren Sie bei „passender“ Gelegenheit meinen Wunsch – NICHT mit Ihnen diskutieren zu wollen – denn ich habe ähnlich wie Sie: „Keine Lust auf Palaver . . . !“

        DANKE, für Ihr Verständnis.

  7. Man kann nur sagen: Die Leute sind kollektiv irre geworden. Am Schlimmsten ist für mich die Masse, die den Wahnsinn einfach so hin nimmt. Anstatt zb. Urlauber einfach den Maskenwahn nicht befolgen – aber darauf kommt keiner. Das Gejammer, man werde ja überwacht und bestraft, kann ich nicht mehr hören, das hört sich an wie im Kinderzimmer. Leute, werdet endlich erwachsen und wehrt euch. Wieso macht ihr das alles mit?

    1. @teutoburgswaelder

      „Man kann nur sagen: Die Leute sind kollektiv irre geworden. Am Schlimmsten ist für mich die Masse, die den Wahnsinn einfach so hin nimmt.“

      Die Erfinder setzen wie beim Klimawandel auf Angst und unterlegen sie mit verfälschten Statistiken und Public Relations. Trump hat das mit dem unsichtbaren Feind gut ausgedrückt, auch wenn er es doppeldeutig meinte.

      Sie setzen auf einen Effekt im menschlichen Überlebenstrieb der Vernunft und Logik weitestgehend ausschaltet. Wenn mit dieser Nummer ein kritischer Teil der Herde überzeugt werden kann, folgt der verunsicherte Teil IMMER der Herde, nie der Vernunft (10% reichen meist, Frauen eher als Männer)). Da spielt es kaum eine Rolle, ob jemand mit hoher Bildung oder ein einfacher Bauarbeiter angesprochen wird; der Überlebenstrieb überlagert immer alle anderen Ängste. Im besonderen Fall (z.B. bei Hypochondern) steigert er sich bis zur Manie.

      Die Folge ist Aggression gegen Andersdenkende und die Verwendung von Zirkelschlüssen. Z.B. “ das Virus ist tödlich, weil es tödlich ist“ oder „ich lag mit Corona im Krankenhaus“. Solche Schein-Argumente höre ich dauernd. Im ersten Fall ist jede menschliche Eigenschaft durch Überlagerung gesteigerter Angst zur Panik abgeschaltet, im zweiten ist die Ursache meist in der anerzogenen Abhängigkeit vom sozialistischen Gedankengut, wonach das Leben, schaut man hinter die Fassade dieser Ideologie, von einem gut meinenden Führer bestimmt wird.

      Im zweiten Fall reden wir über einen angestellten Optiker im Brillenladen, der auch einen Hermesshop betreibt.

      Verkäufer: Sie haben keine Maske auf?
      Ich: Nein! Ich brauche keine Maske, weil ich selbst denke!
      Verkäufer: 😁
      Verkäufer: Ich lag Mitte Dezember mit großen Atemproblemen im Krankenhaus und hatte Corona.
      Ich: Wie hat man das damals getestet? Es gibt den fehlerhaften Test doch erst seit Ende Januar!
      Verkäufer: Ich habe es nachtesten lassen!
      Ich: So? Wie geht das denn? Haben Sie einen Antikörpertest gemacht, der ebenfalls fehlerhaft ist?
      Verkäufer: Lassen wir das, 4.20 €. Beim nächsten Mal mit Maske!
      Ich: Beim nächsten Mal bitte ohne leeres Gewäsch!

      Penny-Markt:

      Filialleiter: Bitte verlassen Sie sofort das Geschäft.
      Ich: Nö!
      Filialleiter: Sofort!
      Ich: Nö!
      Filialleiter: Ich rufe die Polizei!
      Ich: Wissen Sie warum Sie abends um 19.30 Uhr gegen kleines Geld Kisten schleppen und ich bei Ihnen Hundefutter kaufe?
      Filialleiter: 😘
      Ich: Weil ich selber denke und Sie lassen denken.
      Filialleiter stutzt: Was soll das?
      Ich: Wenn Sie selbst denken würden, hätten Sie zumindest die Verordnung gelesen. Haben Sie?
      Filialleiter: Bitte verlassen Sie jetzt das Geschäft!
      Ich. Nö. Wer gibt Ihnen den Auftrag das Denken abzustellen und gesetzeswidrige Forderungen zu stellen?
      Filialleiter: Ich habe meine Anweisungen
      Ich: Sehen Sie, jetzt bin ich zufrieden. So zeigen Sie, dass sie Ihren Kopf mit Anweisungen füllen und das Denken gänzlich abgestellt haben. Deshalb schleppen Sie Kisten und ich kaufe jetzt woanders ein. Wo ist ihre moralische Grenze bis sie einer Anweisung nicht mehr folgen. Würden Sie auch mit Knüppel auf mich losgehen?

      Die Verarbeitung solcher Erlebnisse ist nicht jedermanns Sache. Aber sie helfen die zweifelsohne von der Politik erreichte kritische Masse zu verringern, denn der Optiker wie der Filialleiter werden zwar immer wieder zu ihrer irrigen Ansicht aus Angst zurückkehren; sie werden aber nachdenklicher und umso kritischer, je mehr Lügen ans Tageslicht kommen.

  8. Alle, die bei der sofort breit einsetzenden medialen Kampagne um die „neue Normalität“ mit Masken, Abstandsgebot und straffer Regulierung ein mulmiges Gefühl bekamen und denen der nun in Rede stehende Ausfall von Weihnachtsmärkten und Karnevalsumzügen (im Frühjahr 2021!) überhaupt noch auffällt, haben es nun klar gehört: „Corona ist da, Corona bleibt da“ (https://www.zeit.de/video/2020-08/6179795896001/markus-soeder-corona-ist-da-corona-bleibt-da-und-corona-wird-wieder-deutlich-staerker-werden).

    Und damit natürlich auch der grundrechte-suspendierende „epidemiologische Notstand“, mit dem deutsche Behörden in den Freiheitsbereich der Bürger eingreifen können – wie seit dem Ermächtigungsgesetz nicht mehr. Kümmert die wenigsten, immerhin besteht der NATO-Bündnisfall (vom Normalbürger schlicht unbemerkt) ja auch schon seit 2001…

  9. Weil die Angst vor dem Tod so groß ist, verzichten die Menschen auf das Leben.
    Eine böse verschwörungstheoretische Möglichkeit wäre doch auch, dass es gar nicht um den Nachweis von Corona geht. Warum will die WHO immer mehr und immer mehr Tests? Big Pharma, gut vernetzt mit unserem Herrn Spahn, will eigentlich an die Genstruktur der jeweiligen Population eines Landes herankommen. Was mit den Analysen dann passieren könnte, steht bestimmt nicht mehr in den Sternen sondern wird in speziellen Labors schon bearbeitet. Einer gezielten Genmanipulation einer bestimmten Population via Impfe steht dann nichts mehr im Wege. Der Michel zahlt den PCR-Test, hinzu gibt es dann noch eine geheime (anonymisierte?) Analyse der Genstruktur des Getesteten, die von Big-Pharma bezahlt wird. Wer weiß es? Jens Spahn hat ja auch schon die Daten der Gesundheitskarten anonymisiert(?) an Big Pharma freigegeben. War er deshalb bei den Bilderbergern?

    1. Sind Sie Blutspender(in) oder haben Sie in den vergangenen 10 -12 Jahren Blutuntersuchungen (die über KK abgerechnet wurden) durchführen lassen, dann können Sie davon ausgehen, dass Ihr Genom bereits „abgespeichert“ wurde.

      1. @ Erwin Lottermann:

        „Sind Sie Blutspender(in) oder haben Sie in den vergangenen 10-12 Jahren Blutuntersuchungen (die über KK abgerechnet wurden) durchführen lassen, dann können Sie davon ausgehen, dass Ihr Genom bereits »abgespeichert« wurde.“

        Sind nicht bereits ALLE gespeichert?

  10. Nun ja, die hier lesenden wissen es schon, trotzdem zur Erinnerung hier ein Artikel aus dem Blog „Zeitpunkt“.

    —————————————————-
    Zitat:
    Alles steht und fällt mit den «Fallzahlen» – und diese mit dem PCR-Test

    https://www.zeitpunkt.ch/index.php/alles-steht-und-faellt-mit-den-fallzahlen-und-diese-mit-dem-pcr-test-0
    Was misst der Test genau? Und wie geht das praktisch vor sich? Wo liegen allenfalls Fehlerquellen, die das Resultat beeinflussen? Was ist zu beachten, um zweifelsfreie Ergebnisse zu erhalten?

    —————————————————-

    Vor Monaten als es noch nicht genug PCR-Tets gab, wurden hier in der Schweiz sogenannte Corona Fälle konstatiert auf Grund blosser „Wahrscheinlichkeit“.
    Also weil der Eine es hatte, wahr die Wahrscheinlichkeit gross das dessen Kollege es eben auch…..

    Damals aber wusste man ja bereits das der PCR-Test eine fragwürdige Prognose-Methode ist, ja das nur ein Laboruntersuch wirklich Klarheit bringt….. aber diese dauern viel zu lange und sind teuer.
    Krankenkassen übernahmen die zu Anfang nicht und wer wollte da 1000 und mehr Franken hinlegen für eine Abklärung die an der Situation ja nichts ändert.
    Damit gibt es in meinem Umfeld nun mehrere Personen die als Covid-19 immunisiert gelten, es aber ungewiss ist ob sie das auch wirklich sind.

    Die „Antikörper-Tets“ sind nun in Massen vorhanden, aber sie geniessen auch einen sehr schlechten Ruf.

    Eine Diskussion über den „Test danach“ findet jedoch ebenso nirgends statt.

    —————————————

    Ich Arbeite in einer Firma die nur an meinen Standort gegen 140 Beschäftigte hat.
    Momentan ist eine Gruppe von ca. 10 Personen in Quarantäne weil man einen nach 2-3 Tagen leichtem Fieber positiv testete. ( das Nach-Urlaub Syndrom eben (((-: )
    Alle die mit ihm zusammen arbeiteten sind nun im Homeoffice.

    Tja, was wenn in 1 Woche ein PCR Test bei einem von den 10 immer noch Positiv anschlägt ?
    „falsch positiv“ ist ja nun ein Thema. Bei Test aus europäischer Fertigung nimmt man nun 2% als Rate an, bei Chinesischen Tests gabs aber schon Raten von bis zu 40% und die „falsch negativen“ sollten wir da auch nicht vergessen.
    Wie oft wollen wir die Quarantäne wiederholen bevor alle Grund-Immunisiert sind ?
    Wird wenigstens der „Eine“ mittels Laboruntersuch abgeklärt ?

    Ich hatte gestern leichtes Fieber.
    Das Schlafzimmerfenster war offen. Ich schlaffe sehr schnell ein dann auch gut……. weil ich anfangs zu warm hatte ( ich bin ein Öfeli ) strampelte ich die Decke weg….. und wachte Morgens verkühlt auf.

    Ich hatte Fieber……. was aber 1 Stunde später vorbei war, ich kenne das ja schon.

    Was hätte ich tun sollen ?

    Zu Hause bleiben, zuerst aber einen PCR-Test machen gehen, nen Stellvertreter für mich besorgen usw. usf. (((-:

    Und ich habe jeden Tag mit fast allen Mitarbeitern kontakt….. wer müsste da alles in Quarantäne ?

    1. Hallo Herr Roth,

      „Ich hatte Fieber……. was aber 1 Stunde später vorbei war, ich kenne das ja schon.“

      Bereits hier beginnen die Manipulationen, die das Bewusstsein trüben und zu falschen Schlüssen führen.

      Kaum einer hat bemerkt, dass man die allgemeine anerkannte Sicht auf die flexible Körpertemperatur des Menschen mit den „Corona-Fiebermessungen“ einfach über Bord geworfen hat.

      Normalbereich (oral) = 36,8°C – 38,0°C: Subfebrile Temperatur = 38,1°C – 38,5°C: Leichtes Fieber = 38,6 bis 39.0 °C, Fieber beginnt bei 39,1 .

      Die meisten Flughäfen haben einfach ab 37.5 °C. die Passagiere als fiebrig aussortiert, obwohl dies Vorgänge im Organismus sind, die nicht automatisch auf eine Erkrankung schließen lassen. Subfebril bedeutet lediglich, dass der Organismus einen notwendig gewordenen Heilungsvorgang einleitet. Z. B. Ihre Unterkühlung oder ein zu langes Sonnenbad oder nach einem Insektenstich . Ein paar Stunden später ist in der Regel alles vorbei. Und das unbemerkt mehrere Male im Jahr. Hätten Sie nicht gemessen, hätten Sie nichts bemerkt, denn den Unterschied zwischen 37.5 C° und 38.1 C° bemerkt man im allgemeinen nicht. So wird – ausgehend von China – bewusst Panik erzeugt. Welche Temperatur hatten Sie, als Sie morgens gemessen haben? Hatten Sie wirklich Fieber durch einen Temperaturunterschied im Raum oder einfach unbedeutende subfebrile Temperatur ohne weitere Begleiterscheinungen? Das ist dann kein Fieber!

      Fieber entsteht als Teil unseres Abwehr- besser Ausgleichssystems, um den Organismus alsbald wieder in den Normalmodus schalten zu können. Die Informationen werden zentral im Hypothalamus aufgenommen, verarbeitet und als Arbeitsauftrag an Granulozyten, Makrophagen oder Lymphozyten weitergegeben. Bei einer bakteriellen Infektion z.B. wirkt Fieber ab 38° hemmend auf die Vermehrung. Es ist bekannt, dass die meisten Erreger ab dieser Temperatur Fortpflanzungsprobleme haben, sodass die zwei bekannten Arten der T-Helferzellen schneller Überhand nehmen können um für einen Ausgleich zu sorgen. Fieber wird von der aktuellen Wissenschaft als Symptom einer Krankheit verstanden, das ist grundlegend falsch, wie man an den o.e. Ausführungen erkennen kann. Fieber ist vielmehr eine Funktion in unserem dual funktionierenden Universum und damit auch Organismus, um bestimmte äußere negative Einflüsse (Bakterien, Gifte usw) auszugleichen. bzw. wieder in Waage zu bringen. Deshalb ist der heutige Ansatz der medikamentösen Fiebersenkung in den meisten Fällen kontraproduktiv, weil die Ausgleichs-Funktion abgeschaltet ist und das Abstellen der Ursache des Ungleichgewichts verlängert wird.

      Eigenständig denkende Menschen die diesen Zusammenhang noch kennen, wissen deshalb, dass die Fiebermessungen niemals eine Corona Infektion nachweisen können, nicht einmal angesichts der Vielzahl von Ursachen wahrscheinlich machen; weder bei 37.5 ° auch nicht bei 39°. Eigenständig denkende Menschen wissen ebenso wie jeder Dorfarzt und unsere Vorgenerationen es noch wussten, dass die Nomenklatura mit den Messungen andere Ziele verfolgen MUSS. Meine Volksschule gebildeten Eltern sprachen immer von erhöhter Temperatur, wenn ich als Kind „Fieber“ unter 40° hatte. Ich lebe noch. Das wissen um das Vorgenannte würde reichen, um das gesamt Corona-Gebäude zum Einsturz zu bringen. Da aber alle heute bereits bei 37.5° Temperatur angelernt in Panik geraten, kann man die idiotischsten Regeln zur Realisierung von politischen Zielen durchsetzen. So las ich im gelben Forum einen Kommentar eines Foristen, der Masken mit einer Dichte von unter 40 Nanometer für hilfreich hält. Also praktisch luftdichte Gesichtswindeln. Ich wünsche sie ihm nicht, denn er fällt nach 30 Minuten tot um. Der Schwachsinn UND DIE DEKADENZ sind kaum noch zu steigern.

    2. Es gibt keine „zweifelsfreien Ergebnisse“!
      – Der (RT)PCR-Test kann, abhängig vom Cut-Off, beliebige Ergebnisse liefern.
      – Die Kalibrierung des Tests auf eine in Frage zu stellende Sequenz wurde bereits im Januar vom „Hof-Virologen“ festgelegt. Derweil liegt die Zahl der „Mutationen“ des sog. SARS-Cov2 (zumindest) im 3stelligen Bereich.

      -Bei der Probenahme bzw. mit dem Abstrich können aus der Umgebungsluft ebenfalls „Partikel“ aufgenommen werden – Verunreinigungen, die kein zweifelsfreies Ergebnis zu lassen.
      – Die für die Kalibrierung des PCR-Tests verwendete Sequenz finden wir (laut Aussagen diverser Wissenschaftler) überall in Flora und Fauna.
      – und und und und……………………………….. Man muss die offiziellen Verlautbarungen zu Infektions- , Kranken- , Verstorbenenzahlen im Zusammenhand mit COVID19 glauben, eine „ergebnnisoffene“, unbefangene und wissenschaftliche Prüfung dieser Zahlen könnte am Weltbild eines Jeden rütteln.

  11. Vielen Dank für diesen sehr wichtigen Beitrag zur Maskenpflicht, Herr Ludwig. Ich hoffe, sie beide hatten dennoch neben dem Ereignis mit dem älteren gewitzen Kellner weitere schöne Erlebnisse in ihrem Urlaub.

    Ich habe hier ein Flugblatt zusammengefasst. Es ist allerdings nur für Selbstbewusste geeignet, die sich eine freundliche Diskussion zutrauen. Entspannter lebt es sich mit einem Attest vom Arzt, dass für gewöhnlich klaglos akzeptiert wird. Der Text passt auf ein DIN A4 Blatt:

    Ärzte dürfen ein Attest nicht verweigern, wenn sie mit der Mund- und Nasenbedeckung Probleme haben. Alternativ ist dieses Formular nach Ra. Markus Haintz, der u.a. für Michael Ballweg und der Querdenken Bewegung arbeitet, ebenso rechtsgültig. Empirische Studien erwiesen, für Kleinkinder ist die Mimik anderer von höchster Bedeutung für ihre psychische Entwicklung. Die Traumatisierung von Kindern ist nicht nur unstrittig, sondern theoretisch wie auch empirisch längst nachgewiesen. Die angebliche Schutzmaßnahme, die keinerlei Schutz vor Viren bietet, ist ein nachhaltiger Angriff auf die Psyche. https://corona-ausschuss.de/sitzungen/
    https://fassadenkratzer.wordpress.com/2020/08/06/politiker-sind-keine-zeitgenossen-corona-bringt-es-ans licht/
    ___________________________________________________________________

    Unter Berufung auf § 4 Absatz (1) der Corona Verordnung Berlin in der
    Fassung vom 04.08.2020 erkläre ich, dass mir das Tragen einer Mund-Nasen-Bedeckung aus gesundheitlichen und sonstigen Gründen nicht möglich und nicht zumutbar ist.
    Aus folgenden Gründen ist mir das Tragen einer Mund-Nasen-Bedeckung nicht möglich und auch nicht zumutbar:
    1. Gesundheitliche Gründe / Eingriff in Körperliche Unversehrtheit,
    Art 2 II S.1 GG:
    – Freies Atmen mit Mund-Nase-Bedeckung nicht möglich
    – CO2 Rückatmung
    – Fehlende Möglichkeit der ordnungsgemäßen Desinfektion der Mund-Nasen-Bedeckung gemäß der WHO Empfehlungen
    – Feuchtes Klima unter der Mund-Nasen-Bedeckung, gerade bei Hitze
    – Kopfschmerzen und Schwindel beim Tragen einer Maske.
    2. Politische Gründe:
    Das Tragen einer Mund-Nasen-Bedeckung (Maske) ist mit meiner politischen Aktivität bei QUERDENKEN-711 nicht vereinbar, da die sog. „Maskenpflicht“ für mich
    ein Symbol politischer Unterdrückung darstellt, gegen die ich protestiere.
    3. Gesunder Menschenverstand / Infektionsschutz:
    Die Masken bieten keinerlei Schutz gegen Viren oder Bakterien und erzeugen ein falsches Gefühl von vermeintlicher Sicherheit.
    4. Religiöse Gründe:
    Jede Art einer Vermummungspflicht lehne ich als Akt der Unterdrückung ab und zeige damit auch meine Solidarität mit allen unterdrückten Menschen auf der Welt, welchen untersagt wird, ihr Gesicht zu zeigen.
    __________________________________________________________________

    Bitte ggf. einfach streichen, was auf Sie nicht zutrifft und zuschneiden
    Zitat Sophie Scholl: „Das Problem sind die Mitläufer“
    Quelle und mehr wichtige Infos: Selbstanzeige wegen Verstoß gegen Maskenpflicht | Michael Ballweg im Gespräch mit RA Markus Haintz:

    https://www.youtube.com/c/KulturstudioLive/videos
    Dr. Schiffmann zum ausgenutzten Zielscheibeneffekt – https://www.youtube.com/channel/UC94WBmb8xvVUcV_b9Px0P3A/videos

    Herzliche Grüße aus Berlin!

  12. Bayern ist und bleibt ein Obrigkeitsstaat. Es ist klar, dass die CSU und ihre Klientel das Sagen haben. Wer nicht das richtige Parteibuch hat, wird nichts. Ich bin -so nebenbei gesagt- nicht auf das Grundgesetz vereidigt, sondern auf die Bayrische Verfassung und meinem Dienstherren verpflichtet. Maul halten und seine Arbeit machen ist angesagt.

    Nun bricht die heile Welt eines wohl alimentierten Mitarbeiters im öffentlichen Dienst Bayerns ja gerade zusammen, weil das System dem Untergange geweiht ist, obwohl es sich mit der Corona – Thematik noch eine Zeit lang über Wasser zu halten gedenkt. Der vom eigentichen Desaster abgelenkte Bürger wird auch keinen Bankenrun veranstalten, weil er das Haus kaum noch verlassen will, darf und soll. Michel wird auch dann noch zur Arbeit gehen, wenn der jüngste Tag angebrochen sein wird. Der Deutsche lässt dann sogar Jesus und die Gerechten auf seiner Wolke hocken und latscht zum Werkstor, ins Büro oder Amt, seine Brotzeit nebst Thermoskanne im Rucksack. Apokalpse? Ist nicht.

    Ja so sind wir.

    Nur manchmal, in tiefster Nacht, rührt sich was unter der Zippelmütze, wenn Michel davon träumt, wie andere ihn erlösen.

    Meine Vision: Am 29.08.2020 marschiert ein Musik – Corps der Bundeswehr im Hofe des Kanzleramtes unangemeldet auf und intoniert Preussens Gloria. Merkel steht auf einem roten Teppich, während ein Offizier ihr eine Note überreicht, nach der sie mit sofortiger Wirkung abgesetzt ist. Die Macht hat ein Expertengremium unter Kontrolle der Bundeswehr übernommen. Bis eine neue Verfassung nach Schweizer Vorbild vom Deutschen Volke in freier Wahl verabschiedet ist. Und draußen 3 Millionen jubelnde Demonstranten.

    Söder? Uninteressant.

  13. Widerstandsrecht gegen Merkel, Söder und Konsorten?

    Das verfassungswidrige Verhalten von Merkel und Söder wirft die Frage auf, ob das Deutsche Volk nunmehr ein Recht zum Widerstand hat.

    Auch heute müßte es doch verantwortungsvolle Offiziere der Bundeswehr geben, um Verbrecher von der Spitze des Staates zu entfernen.

    In der Deutschen Geschichte haben sich ja schon einmal hohe Militärs für ihr Gewissen und gegen ihre Pficht zum Gehorsam entschieden.

    Ist denn da niemand, sich mit Trump und Putin abzusprechen, um Merkel vom Kanzleramt in den Hausarrest zu verfrachten, bis ihr der Prozess gemacht werden kann? Wegen mehrfachen Hochverrates!

    Das gleiche gilt für Söder und Konsorten. Absetzen, verhaften und vor Gericht stellen.

    Das kann nur die Bundeswehr.

    HALLO, IST DA JEMAND?

    1. @Waltomax:“…ob das Deutsche Volk nunmehr ein Recht zum Widerstand hat.“

      Das Deutsche Volk hat ein Recht, zum Mars zu fliegen und dort eine Kolonie zu bauen, aber mit Recht allein fliegt noch nichtmal jemand zum Mond. Das braucht mindestens eine Sylvesterrakete aus Polen und einen Helm aus Amerika.
      Und ob man dann trotz der Fahrkarte mit Garantie auf Rückflug zum Erdboden in Düsseldorf heil ankommt, ist auch eine Preisfrage, nicht wahr?

      Und was sind Soldaten anderes als willenlose Roboter, die sich bewegen, als seien sie Maschinen? Man hat denen in den Schulen schon beigebracht, dass es einen Willen gar nicht gibt, denn den hat man nirgends unter dem Mikroskop finden können.
      Wenn es dem Soldaten befohlen wird, trägt der auch Masken über den Knien und noch eine über dem Helm.
      Ja, es gab mal Militärs, die sich gemäss ihrem Gewissen entschieden hatten.
      Die wussten damals nur noch nicht, das Zombies ohne Willen gar kein Gewissen haben können.

    2. @ Waltomax: „Bundeswehr“.

      Ich weiß nicht, wie sehr Trump und Putin wirklich auch „an einem gemeinsamen Strang ziehen“. Ich verweise diebezüglich auf das, was Herr Schütze und Frau Kathrina bereits gesagt haben, und das „Zitat: »29.8.2020: Stürzen Querdenker die Regierung?«“ von Vier. Rußland ist seit einigen Jahren wieder eine Großmacht und geostrategisch für Deutschland sehr bedeutsam. Deshalb sollte Deutschland, das ja auch eine Großmacht ist, sich mit ihm gut verstehen. Die einzige Weltmacht, die es gibt, sind die Vereinigten Staaten von Amerika. Sie mag bald in dieser Position von China verdrängt oder zumindest eingeholt werden, so daß wir es dann mit zwei Weltmächten tu tun haben würden und wohl auch werden. Das, was hier passiert, muß abgesprochen werden, weil es sowohl von der westlichen Seite als auch von der östlichen Seite abgesichert sein muß. Also dürfen die Interessen der Vereinigten Staaten auf der einen und China auf der anderen Seite nicht dagegen sprechen. Das müßte aber zu regeln sein. So gesehen: „Bundeswehr, marsch, marsch!“.

      Verhaftung, Gericht, Gefängnis.

      Mehr kann ich dazu auch nicht sagen.

      Wie ist das denn in den anderen Ländern? Es ist ja trotz oder wegen dieser Maulkorb-Diktatur noch nirgendwo eine Regierung gestürzt worden.

  14. Mehr als 15.000 bei einer Poolparty in Wuhan-dicht an dicht im Wasser, ohne jede Maske. In Weißrussland zehntausende Farbenrevolutionäre -dicht an dicht, ohne jede Maske- die Bundesregierung findet das gut.
    https://www.journalistenwatch.com/2020/08/17/ohne-maske-abstand/
    Nur hierzulande ist sowas angeblich „gesundheitsschädlich“ und soll die „Pandemie“befördern- wer glaubt sowas noch? Zu Viele.

    Herr Sucharit Bhakdi (emeritierter Professor der Johannes Gutenberg-Universität Mainz und war von 1991 bis 2012 Leiter des dortigen Instituts für Medizinische Mikrobiologie und Hygiene) wird nicht müde zu erklären, was das Tragen von Masken, wie im „Merkelland“ praktiziert, für ein Unsinn sei- geradezu horrende Schäden v.a. bei Kindern produziert.
    Und überhaupt, wo sind bei den vielen positiv Getesteten denn die entsprechenden schweren Krankheitsfälle abgeblieben? Die gibt es nach Bhakdi überhaupt nicht, seit 3 Monaten ist das so.

    In der öffentlichen Darstellung tut man indes so, als wenn all die (durch zahllose Test’s festgestellten) „Infizierten“ ernsthaft Kranke wären- man unterscheidet nicht und dies ist „verlogen“. Diese LÜGE leitet sich schon vom Begriff einer Pandemie her: Pandemie= sich weit ausbreitende, ganze Landstriche, Länder erfassende Seuche; Epidemie großen Ausmaßes; Seuche= gefährliche ansteckende Krankheit, die sich schnell ausbreitet; Epidemie= das Auftreten einer ansteckenden Krankheit in einem bestimmten begrenzten Verbreitungsgebiet (wobei eine große Zahl von Menschen gleichzeitig von der Krankheit befallen wird).

    Aber wo ist diese angebliche GROSSE ZAHL kranker Menschen? Im Kopf der Berufs-Poltitiker, die sich auch nicht scheuen, die Andersdenkenden und Tatsachen Anerkennenden als COV-Idioten zu bezeichnen?

    Stellt sich die Frage: Was soll der ganze Quatsch? Ist das ein Test für den Grad der inzwischen erreichten Massenverdummung? Oder haben hier einige politisch Verantwortliche die Hosen so voll, dass sie sich nicht mehr getrauen einzugestehen, dass man sich mit der Corona-Pandemie auf’s Glatteis der WHO-Hintermänner und Impf-Mafia führen lies und der Lockdown, der das Land wirtschaftlich ins Nirwana katapultiert, ein katastrophaler Fehler war- den das Volk teuer bezahlen wird/ muß- neben den anderen Fehlleistungen der Merkel und ihrer politischen Entourage? Oder schlimmer: war der Lockdown notwendig, um etwas ganz anderes zu verdecken, nämlich dass das ganze System am Ende und der Globalismus eine Sackgasse und nur noch über den Totalitarismus zu retten ist? Merkel meint schon mal, die „Zügel“ straffer anziehen zu müssen….
    Mal sehen auf der Massen-Demo am 29.8.2020 in Berlin, wie viele das ganz anders betrachten.

    1. @ Vier:

      „Oder schlimmer: war der Lockdown notwendig, um etwas ganz anderes zu verdecken, nämlich dass das ganze System am Ende und der Globalismus eine Sackgasse und nur noch über den Totalitarismus zu retten ist?“

      Das ist mit sehr hoher Wahrscheinlichkeit so. Auch dürfen Sie nicht vergessen, daß diese „Ausnahmeländer“ nicht wirklich Ausnahmeländer sind: China hat angefangen mit dem Quatsch. Und in Weißrußland wird gerade eine Exempel statuiert. Warten Sie einmal ab, was da noch passiert! Ja, und Schweden …, und das waren sie auch schon. Es steckt immer ein Grund dahinter. Man sollte das Ganze auch ganzheitlich verstehen. Es betrifft den gesamten Globus. Wenn also irgendwo „Ausnahmeländer“ erscheinen – es sind ja, und zwar aus Absicht, immer nur ein paar -, dann folgt bald eine bestimmte Aktion in diesen „Ausnahmeländern“.

    2. @vier:“Mehr als 15.000 bei einer Poolparty in Wuhan-dicht an dicht im Wasser, ohne jede Maske.“

      Auch in Russland, so berichtete zumindest RT DEUTSCH, geht man ohne Masken.
      Warum das hierzulande anders ist, wird erst verständlich, wenn wir uns fragen, OB es WELCHE wirtschaftlichen Gründe FÜR WEN gibt, uns Deutsche von den Russen fernzuhalten.
      Wer will uns den Landweg, der bis China führt, seit über hundert Jahren versperren ?

      Warum will sogar Trump die Gasleitungen, die Russland mit Europa verbinden sollen, uns nicht gönnen ?

      Ein Volk, dem man den Mund verbietet, indem man es maskiert, hat ANGST, und ANGST hindert am klaren freien Denken. Wer nicht frei denken kann, ist kein wirtschaftlicher KONKURRENT und fällt herein auf die Phrasen von „Globalisierung“, die nur verschleiern, um was es IN WAHRHEIT geht. Es geht um die Ziele angloamerikanischer Nationalisten.

      1. @Michael – was sie da mit Russland anschneiden, sehe ich durchaus ähnlich, aber es ist nur ein Aspekt von vielen. Das Ganze ist in seiner Struktur ein von vielfältigen Interessen dominierter Machtkampf auf möglichst kleiner Flamme. Schließlich will MAN die Macht über den „Globus“ und nicht über eine Wüste, eine atomar vernichtete Welt. MAN will das „Beste“ und möglichst unversehrt für sich – da stören die Massen nur – und das Ganze nennt sich New World Order (nur ein anderer Name für Globalismus). Wie MAN sich das vorstellt, kann jeder in Georgia nachlesen und sich in kluger Rede vom Philosophen Armin Risi erklären lassen, welche r weitab vom Hass – seit vielen Jahren die Menschenliebe predigt, Verurteilungen ablehnt – indes die „Unterscheidung“ als notwendiges Mittel zum Überleben erkannt hat.
        So sollte eigentlich ein Jeder unterscheiden lernen und sich nicht verarschen lassen von einer angeblichen Gleichheit von „Infizierten und Kranken“ oder „Globalisierung und Globalismus“.

        ….und den vielen anderen Schöpfungen täglich neuer (Schein-) Realitäten der PR-Industrie, im Auftrage der HinterMächte (MAN= cui bono oder die Abkömmlinge von „Mutter Nacht“= der Ursprung allen Übels), die ungehemmt in die NSN gedrückt und von dort aus, mit medialen Getöse, korrumpierend und Angst erzeugend unsere Sinne vernebeln und lügenhaft auf Dummheiten fokussieren.

      2. @Michael

        „Es geht um die Ziele angloamerikanischer Nationalisten.“

        Vermutlich meinen Sie angloamerikanische Internationalisten? Denn Nationalisten sind in erster Linie daran interessiert Vorteile für eine fest definierte Volksgruppe zu generieren, die in aller Regel zu einem Staat zusammengefasst ist. Internationalisten hingegen streben nach hegemonialer Macht über alle Grenzen hinweg und kümmern sich nicht um nationale Befindlichkeiten; auch nicht der eigenen Bevölkerung.

        1. @hubi Stendahl

          Was oder wer sind Internationalisten? Sind es angloamerikanische Kreise um Skull & Bones herum, die den A.H. extra dafür bezahlten, gegen Russland zu kämpfen und gleichzeitig Stalin dafür bezahlten, gegen Deutschland zu kämpfen, so dass im Ergebnis
          Russland schwach und kommunistisch war und Deutschland besetzt ist und nicht selber frei ist, zu bestimmen?

          Wessen Sprache verdrängt denn die deutsche Sprache? Ist es etwa die Sprache der Angloamerikaner, die englische Nationalsprache?

          Diese Nationalisten zwingen uns heute zum Tragen von Masken und haben die sogenannten Indianer gezwungen, die englische Sprache zu sprechen und die eigene Sprache als Dreck zu betrachten, denn wenn ein Indianer nicht englisch sprach, musste er sich den Mund mit Seife auswaschen. Sind das etwa die Internationalisten ?

    3. Interessant – „Ist das ein Test für den Grad der inzwischen erreichten Massenverdummung?“ – Nicht nur das, auch ein zweifelsfreier Beweis für die Korrumpierung unserer Funktionseliten und – ach ja – selbstverständlich auch der Medientreibenden, denn die treiben’s ja richtig doll.

    4. @ Vier:

      „Mal sehen auf der Massen-Demo am 29.8.2020 in Berlin, wie viele das ganz anders betrachten.“

      Vier! Vier Millionen werden kommen.

      @ Vier:

      „ Siehe hier: Zitat: »29.8.2020: Stürzen Querdenker die Regierung?«.

      Danke.

      Panzer werden wohl nicht eingesetzt werden, aber die Regierung wird wohl zum Rücktritt gezwungen werden, wenn die Demonstranten wieder Millionen sein werden (siehe oben: „Vier Millionen werden kommen.“).

  15. Nachtrag zum ersten Kommentar für das Eigenattest. Die jeweilige Landesverordnung ist natürlich zu berücksichtigen und ggf. das Eigenattest anzupassen. Anwälte für Aufklärung: https://www.afa.zone/beitraege/ivett-kaminski/maskenpflicht-keine-mitfuehrpflicht-von-attesten-kein-einsichtsrecht-in-atteste/
    Zur Belustigung noch eine Komödie nach dem gleichnamigen Roman von Heinrich Spoerl „Der Maulkorb“ bei Gunnar Kaiser. https://www.youtube.com/watch?v=COjhdwEtXxc

  16. Ja, das ist die große Frage: Wer sind die Autoren und Regisseure dieses schauerlichen Theaterstückes?
    Toller Artikel und leider sehr real vorstellbar – auch außerhalb Bayerns. Es scheint immer schlimmer zu werden und viele einstmals humorvolle, souveräne Mitmenschen beginnen, sich höchst eigenartig zu entwickeln. Lauernde und angsterfüllte Augen starren zwischen dem festgezurrten Mund-Nasen’Schutz‘ und dem salatschüsselgroßen Fahrradschutzhelm in eine virenverseuchte Welt… Man wähnt sich im ‚falschen Film‘,- aber er ist real, und er ist in seiner totalitären Botschaft ziemlich bedrohlich

  17. Der Autor geht beim Gefahrenleugnen in diesem Fall genau so weit wie in anderem Fall die Multikulti-Freunde. Die ideologische Herangehensweise lässt einen an der Machbarkeit von Demokratie in Buntschland und anderswo verzweifeln. Harte Fakten sind zumindest, dass die chinesische Wirtschaft wächst, während die der westlichen Länder, die sich ständig mit wehleidiger Menschenrechthaberei und buntem Bullshit (sei es von Rassenleugnern oder Virenleugner) herumschlagen müssen, massiv schrumpft https://bayernistfrei.com/2020/08/19/wuhan-party/.

  18. „… ganz harte Bußgelder“

    Genau darum geht es doch! Die benötigen mehr Geld für die „Kulturbereicherer“.
    ___

    Betrifft: Corona-Verordnung.

    Eine Verordnung benötigt eine Gesetzesgrundlage um Wirksamkeit zu erlangen.
    Das Seuchenschutzgesetz bezieht sich auf „Kranke, Krankheitsverdächtige, Ansteckungsverdächtige oder Ausscheider“.
    Ein Pauschalverdacht ist nicht hinreichend begründbar, wenn man die geringe Positivrate der Getesteten berücksichtigt.

    Da die Exekutive an Recht und Gesetz gebunden ist (Art. 20 (3) GG), muß jede Maßnahme der öffentlichen Verwaltung auf ein gültiges Gesetz zuruckführbar sein.

    Somit erkenne ich hier die rechtliche Unwirksamkeit der sogenannten Corona-Verordnung, da ihr offensichtlich die gültige Rechtsgrundlage fehlt.
    ___

    Betrifft: Impfzwang

    §28 (3) IfSG: Eine Heilbehandlung darf nicht angeordnet werden.

    Ein Impfpflicht verstieße zudem gegen das Recht auf körperliche Unversehrtheit (Art. 2(2) GG).

    Eine Zwangsimpfung bedeutete einen tätlichen Angriff auf Leib und Leben und rechtfertigte sogar geeignete Notwehrmaßnahmen.

    1. Hoppla, da ist noch jemand wach!
      🙂

      „Das Thüringer Oberverwaltungsgericht muss sich mit einem Eilantrag gegen Maskenpflicht und Abstandsgebot beschäftigen. Der Eilantrag kommt aus den eigenen Reihen: Ein Thüringer Richter kann für die verhängten Verordnungen keine verfassungsmäßige Rechtsgrundlage erkennen und findet sie darüberhinaus unverhältnismäßig.“

      (gefunden hier:
      https://alternative-presseschau.com/corona-skandal-thueringer-richter-will-soeder-vor-gericht-bringen/)

  19. Die Behauptungen in diesem Artikel sind teilweise grob falsch.
    Die „Fehlerquote“ von PCR-Tests liegt nicht bei „2 %“, sondern
    bei „96 %“ (Prof. Bhakdi)! Das ist ein Unterschied – 96 : 2 = 48 –
    um den Faktor 48! Also nicht gerade ein Klacks! Ob ich
    2 Millionen Euro oder 96 Millionen Euro habe, das dürfte –
    zumindest einem durch und durch geschmierten Provinzpolitiker
    nicht ganz egal sein. Oder soll man nicht von Schmiergeld reden,
    sondern von „Tantiemen“ und die Politiker spielen uns
    verlogenste Theateraufführungen vor? (und das auch noch
    ziemlich mies!)
    Was auch nicht stimmt – das behaupte ich aufgrund meiner naturwissenschaftlichen Kenntnisse und meiner eigenen monatelangen (teilweise bis zu mehrere Stunden am Tag)
    Recherchen zu Corona – dass hier „288 Corona-Patienten“ –
    (wenngleich mit abnehmender Tendenz) in den Kliniken liegen.
    Ich streite nicht die Zahl ab, aber die Tatsache, dass die an
    „Corona“, „Covid-19“ etc. leiden! Diese Patienten haben
    ANDERE KRANKHEITEN, die auf „Corona“ UMETIKETTIERT
    wurden und werden, so wie das mit den Toten ja auch
    gemacht wird. Und das nicht ohne Grund! Erstens wird von der
    VERBRECHERPOLITIK ein ungeheurer krimineller Druck
    aufgebaut, zweitens rentiert es sich unglaublich, wenn man bei
    diesem Verbecherspiel mitspielt: jeder kleine Hausarzt oder
    Klinikarzt bekommt innerhalb 1 Woche bis 10 Tagen 10.000 Euro
    von Bill Gates bzw. seiner Organisation aufs eigene(!) Konto
    überwiesen, wenn man einen Verstorbenen per Totenschein als
    „Corona-Toten“ ausweist. Nachricht per E-Mail und Faksimile
    des Totenscheins als Attachment genügt.
    Und in welchen astronomischen Grössenordungen höhere
    Politiker bestochen werden, flog ja mit dem weissrrussischen
    Präsidenten Lukaschenko auf, dem man zuerst „92 Millionen
    US Dollar“ anbot, wenn er in Belarus einen „Lockdown wie in
    Italien“ macht und nachdem er ablehnte, das Angebot auf
    „940 Millionen US Dollar“ verzehnfachte! Was ein anständiger
    Politiker wie Lukaschenko ebenfalls ablehnte. Leider findet
    man in der BRD praktisch keine anständigen Politiker mehr.
    Allerdings gibt es in Deutschland schon immer eine „Partei“,
    die als „Schmiegeldpartei“ gilt, deren Politiker von vorne bis
    hinten durchgeschmiert sind. Schon mit 15 Jahren sagte mir
    jemand bei einer öffentlichen Diskussionsveranstaltung, die
    von unserem Gymnasium zur damaligen Bayernwahl
    organisiert worden war, in diese gewisse Partei würde man
    „nur eintreten, um Schmiergeld kassieren zu können.“ Der gleiche
    Unternehmer sagte mir, dass ihm eine Baugenehmigung für eine
    weitere Fabrikhalle über einige Jahre verweigert worden sei.
    Schliesslich sei ihm von einem Behördenmitarbeiter
    „vertraulich“ gesteckt worden, dass eine Schmiergeldzahlung
    erwartet würde, dann würde der Antrag „innerhalb 14 Tagen“
    bearbeitet. Nachdem sich der Unternehmer dazu durchgerungen
    hatte, das Schmiergeld zu bezahlen, bekam er seine
    Baugenehmigung innerhalb 1 Woche! Tango corrupti!
    Auch in Paraguay und anderen Ländern fliegt jetzt auf, dass die
    WHO und andere „Gates-Organisationen“ den Politikern
    Schmiergelder zahlen, wenn sie ihre Völker schikanieren und
    die Wirtschaft ruinieren.
    Der ganze Corona-Quatsch ist ein einziger FAKE, HOAX und
    SCHWINDEL. Corona ist nichts anderes als ein 0815 bekannter,
    harmloser Schnupfen-Virus! Man stirbt an „Corona“
    genausowenig wie an Schnupfen! Alles andere(!) wie
    „Corona-Kranke“, „Corona-Tote“ sind Schwindel und Betrug,
    um alles kaputtzumachen, ein Riesen-Chaos, eine
    Riesen-Krise zu entfachen, mit der diese
    VERBRECHER-POLITIKER ihre hochkriminelle NWO errichten
    wollen. Diese Toten gibt es zwar tatsächlich, aber die sind ALLE(!)
    an was anderem gestorben, quantitativ am meisten an
    Altersschwäche (80-jährige, 90-jährige Tote!!), Herzinfarkt,
    Hirninfarkt, Nierenversagen, Krebs(!) oder von Leiter gefallen,
    oder von Auto überfahren.
    Der beste Beweis dafür ist, dass es keine sog. „Übersterblichkeit“
    gibt! Es sind also in 2019 und 2020 nicht mehr Leute gestorben,
    wie sonst! Sogar weniger! (es gibt z.B. „Kurzarbeit“ bei
    Bestattungsinstituten!) Und das „trotz“ Corona! (ist auch klar
    warum, es trauen sich keine Leute mehr ins Krankenhaus, um
    dort nicht als „Corona-Kranker“ komplett entmündigt(!) und
    zu Tode „therapiert“ zu werden!; die Leute sterben ja in Wahrheit
    an den Operationen und den Krankenhauskeimen!; das ist kein
    Scherz, das ist mit wissenschaftlichen und statistischen
    Untersuchungen schon Anfang der 70er Jahre festgestellt
    worden!)
    Lassen Sie sich bloss nicht impfen! Reicht es Ihnen denn nicht,
    dass Bill Gates SELBER(!!!) in der öffentlichen Fernsehsendung
    sagt – wobei er sich übrigens ein hämisches Grinsen über die
    Dummheit der Leute immer nie verbeissen kann!; beobachten
    Sie das mal! – , dass seine Impfungen der
    – – – – – – – – – – BEVÖLKERUNGSREDUKTION! – – – – – – – – –
    dienen und es mindestens „700.000 Opfer“ geben wird!
    Wollen Sie etwa dazugehören? Es handelt sich übrigens
    um eine zuvor nie erprobte GEN-VERÄNDERNDE IMPFUNG!
    Wissen Sie noch den Skandal, der um „Contergan“ gemacht
    wurde? Die Verantwortlichen öffentlich runtergemacht in den
    Medien, die Firma als „Nazi“-Unternehmen hingestellt!
    Aber heute darf man im Ethno-Fernsehen im Land der
    Verblödeten (die ja auch diese Politiker immer tatsächlich
    wählen, egal, was die tun!) schon ganz cool „700.000 Opfer“
    ankündigen? Da sehe ich aber die von Juden behauptete
    „Singularität“ des „Holocaust“ ganz schön bedroht, besonders
    dann, wenn bei dieser Corona-Impfung noch etliche mehr ins
    Gras beissen und sich die Radieschen von unten ansehen werden.

    1. @ Voodoo Magier

      Hier der Beweis: Es gibt keine Übersterblichkeit (mehr) in Euroland:

      Mortality levels approaching normal in Europe
      Overall pooled estimates of all-cause mortality show normal levels for the countries participating in the EuroMOMO network. In some countries in Southern Europe, however, there seems to be a small excess mortality, which could be related to local heat waves.

      Data from 24 participating European countries or regions were included in this week’s pooled analysis of all-cause mortality.

      EuroMOMO Bulletin, Week 33, 2020
      https://www.euromomo.eu/

    2. ZITAT @ VOODOO MAGIER:
      “ . . . es trauen sich keine Leute mehr ins Krankenhaus, um
      dort nicht als „Corona-Kranker“ komplett entmündigt(!) und
      zu Tode „therapiert“ zu werden!; die Leute sterben ja in Wahrheit
      an den Operationen und den Krankenhauskeimen!“

      BINGO!

      WANN traut sich der erste Arzt an die Öffentlichkeit, der diese kriminelle „Corona-Um-Ettikettierung“ im TOTENSCHEIN – gegen CASH von KiLL BiLL Gates – als erstklassigen BEWEIS vor Gericht BEKANNT macht?

      HIER der „passende“ Rechts-Anwalt für die internationale MEGA-KLAGE:

      Titel:
      „Money Talks II“
      HIER alle anderen Videos im YouTube-Video-Kanal von Dr. Reiner Füllmich:
      https://www.youtube.com/channel/UCJB8ANhWVhgQf9Rw-KJo26Q

      Falls dieser YouTube-Kanal ZENSIERT werden wird – wie das derzeit bei Google überhand genommen hat – HIER die eigene homepage des furchtlosen Doktors der Juristerei aus Göttingen:
      https://www.fuellmich.com

      Endlich ein zu 100 Prozent legaler, professioneller & gangbarer Weg für ALLE Unternehmen & ALLE Unternehmer rund um den deutschen Mittelstand – um der durchgeknallten Regierung zu zeigen – WER die deutsche Wirtschaft am Laufen hält & WO genau der echte Hammer hängt . . .

      1. @Kalle Möllmann

        Haben Sie sich schon einmal folgende Fragen gestellt:

        Warum betont Dr. Fuellmich in fast allen Videos des Corona-Ausschuss, er sei gegen „Verschwörungstheorien“?
        Warum wurde dort noch nicht ein einziges Mal über ID2020, Event201 und „The Great Reset“ des World Economic Forums gesprochen?

        Wer soll eigentlich zur Rechenschaft gezogen werden, wenn Dr. Fuellmich & Kollegen mit dieser Sammelklage durchkommt? Wird die Immunität der Politiker aufgehoben und haften diese dann mit ihrem Privatvermögen?
        Oder wird wie immer der Steuerzahler die Zechen berappen und somit doppelt und dreifach belastet?

        1. @ Zitrone.

          Wenn ich auf Ihre Fragen antworten darf:

          „Warum betont Dr. Füllmich in fast allen Videos des Corona-Ausschusses, er sei gegen »Verschwörungstheorien«?“

          „Trojanisches Pferd“ namens Reiner Füllmich. Sehen Sie dazu, was der geistig sehr bewanderte Herr Lottermann und ich zu dem Thema „Unterwanderung“ geschrieben haben.

          https://fassadenkratzer.wordpress.com/2020/08/20/totale-masken-macht-im-soder-land/comment-page-1/#comment-16664
          https://fassadenkratzer.wordpress.com/2020/08/20/totale-masken-macht-im-soder-land/comment-page-1/#comment-16669

          „Warum wurde dort noch nicht ein einziges Mal über ID2020, Event201 und »The Great Reset« des World Economic Forums gesprochen?“

          Siehe: 1. Antwort.

          „Wer soll eigentlich zur Rechenschaft gezogen werden, wenn Dr. Füllmich & Kollegen mit dieser Sammelklage durchkommen?“

          Deutsche Steuerzahler.

          „Wird die Immunität der Politiker aufgehoben und haften diese dann mit ihrem Privatvermögen?“

          Nein. Selbstverständlich nicht.

          „Oder wird wie immer der Steuerzahler die Zechen berappen und somit doppelt und dreifach belastet?“

          Ja. Eher vierfach bis x-fach.

          Danke für Ihre Fragen, die auch ein Licht auf die Naivität derer werfen, die diesem Linksanwalt Füllmich glauben. Man merkt ihm auch ganz deutlich seine Doppelzüngigkeit an. Er könnte auch einer der Trolle unter den hier Kommentierenden sein. Füllmich ist ein Unterwanderer. Vor allem aber ist entlarvend, was Sie in Ihren Fragen ja schon angedeutet haben, denn Füllmich heuchelt, läßt Teile des Themas aus, eliminiert sie, ersetzt andere Teile des Themas so, daß sein Text den Naiven nicht wie ein vom Lügenmainstream unterwanderter, sondern wie ein vom „Widerstand“ kommender „kritischer“ Text erscheint.

          Das Thema ist ja den Nichtnaiven hier bekannt.

          —————————————-

          @ Zitrone:

          „Fundstück: …. Eine der WHO-Primersequenzen im PCR-Test für SARS-CoV-2 findet sich in der gesamten menschlichen DNS! ….
          Homo-sapiens-Chromosom 8, GRCh38.p12 primäre Versammlung.
          Sequenz-ID: NC_00000008.11 – Länge: 145138636.
          Bereich 1: 63648346 bis 63648363 ist ,CTCCCTTTGTTTGTGTTTTGT’. ….“

          Danke noch einmal.

          Und jetzt?

        2. @Kathrina

          „Und jetzt?“

          Sie sind ein extrem aufmerksamer Mensch. Ihre Fragen zum Ausschuss beschäftigen mich seit der zweiten Sitzung. Und ich kommen zum gleichen Schluss.

          Ohne die Demos in Berlin zu kritisieren, im Gegenteil, sie sollten in Anspruch genommen werden; aber auch Ballweg von Querdenken 0711 ruft in mir Warnzeichen auf. Er macht diese Demo zu einer bunten Hippie Veranstaltung, wie man anhand des Equipments feststellen kann. Seine Vita gefällt mir auch nicht.

          Wer bezahlt diesen immensen Aufwand für Logistik und Technik? Wer steht hinter diesem Programmierer, der nach eigenen Aussagen mit den großen internationalen Konzernen in Geschäftsverbindung stand oder steht mit einer Verfolgungssoftware, mit der er sogar das eigene Kind hat überwachen lassen. Hat er die Aufgabe die Massen zu binden? Immerhin hört man auf der Bühne nichts weiter als die Forderung zur Aufgabe der Maskenpflicht und Friede, Freude, Eierkuchen. Ich bin zunächst auch hier skeptisch. Mir fehlt das eindeutig formulierte Ziel!!!

        3. @Katharina

          Oh, jetzt ist mir @hubi stendahl mit seiner Antwort zuvorgekommen. Trotzdem stelle ich meinen vorbereiteten Text hier ein.

          Zunächst einmal vielen Dank für Ihre Replik! Was den kontrollierten Widerstand angeht, sehe ich inzwischen auch eine Neuauflage der 68er Bewegung. Die Veranstalter von Querdenken und einige der Hauptpersonen, die auf deren Bühnen sprechen dürfen, faseln ganz im Sinne der Neuordner der Welt, ständig von einer “Menschheitsfamilie”, also im Sinne von “Wir alle sind eins”.

          Will man aus diesem Grund unbedingt die paradiesbunte Antifa mit ins Boot holen, wie man hier, ab Min 12:30, hören kann?

          Querdenken Demo Hamburg 15.8.2020 – Bodo Schiffmann, Anselm Lenz, Michael Ballweg –

          Anselm Lenz ist unverkennbar ein begeisterter Anhänger der Antifa:

          Ist Ihnen schon einmal aufgefallen, dass Leute wie Schiffmann, Ballweg, Lenz & Co., niemals andere politische Themen ansprechen, wie z.B. den Migrationspakt, tägliche Messerstechereien und Vergewaltigungen von Frauen aller Altersgruppen? Und genau wie Dr. Füllmich verschweigen sie ihren inzwischen millionenfachen Anhängern Themen wie: “The Great Reset”, Event201, uvam.

          Zu all diesen Leuten, die plötzlich wie Phönix aus der Asche auftauchten, gehört auch ein bekannter Photograph, der mit allen Größen der Querdenker irgendwie verbandelt scheint.

          https://www.kunst-fuer-alle.de/deutsch/kunst/kuenstler/kunstdruck/kai-stuht/28353/1/554774/beauty-and-the-beast/index.htm

          Diogenes Lampe machte sich ebenfalls Gedanken über “Herrn Ballweg und die Neue Love-Parade” – Teil 1

          https://www.dasgelbeforum.net/index.php?id=537880

        4. Anhang an @Katharina

          Meine Fragen sollten das Forum einfach nur zum Nachdenken anregen. Um sich nicht all zu sehr von den vielen Aktionen, die zur Zeit laufen, blenden zu lassen, sollte man alle Seiten abklopfen. MMn werden derzeit viele Menschen, in Bezug auf den 29. August, in eine Art Euphorie versetzt, die ihnen eine Lösung nur vorgaukelt.
          Wirklich drängende Probleme, die außerhalb des Corona-Themas liegen, wie z. B. die illegale Migration, werden von den ganz oben stehenden Querdenker-Köpfen, nie thematisiert. Warum?

        5. Antwort an Zitrone zu Querdenken Hamburg. Ich war bei der Gründung von Pegida HH vor Jahren. Mir fiel auf, daß die gleich bei den ersten Treffen Kartons mit Hochglanzpapier-Flugblättern hatten, dann daß das Treffen mitten in einem Cafe war, wo man nur flüstern konnte und dann kam die Wahl des Vorstandes, wo ich hineingewählt wurde. Am nächsten Tag wurde ich per Mail wieder rausgeschmissen, weil ich den Leiter der Gedächtnisstätte Guthmannshausen kenne. Woher wußte er das? Pegida wurde gegründet, um es dann einschlafen zu lassen. In HH braucht man nichts auf die Beine zu stellen, da ist alles links-verseucht.

        6. @ Hubi Stendahl (22. August 2020, 08:02) .

          Danke.

          Ja, so hat auch „Achtundsechzig“ funktioniert. Die „Revoluzzer“ und „Hippies“ fühlten sich schon wie „die höchsten Tiere“ aus Orwells Fabel „Farm der Tiere“ („Animal Farm“) dem Machthimmel sehr nahe. Und nach diesem Muster haben auch alle anderen sogenannten „Revolutionen“ funktioniert. „ Immer dann, wenn von „Revolution“ gesprochen wurde und wird, war und ist Unterwanderung durch Geist und Geld die Ursache, wie auch Herr Schütze schon gesagt hat. Ein Beispiel aus jüngerer Zeit: Auch „Achtundsechzig“ ist ja besonders von den Intellektuellen als „Revolution“ bezeichnet worden, und daß diese Intellektuellen unterwandert, von der Frankfurter Schule beeinflußt waren und sind, ist bekannt.“ (Kathrina, 21.08.2020. 01:38). Damit ist auch die von Ihnen gestellte Frage nach der Bezahlung und der Hinterleute, schlußfolgernd auch die Frage nach dem Massenbindungsauftrag und der Ziellosigkeit beantwortet.

        7. @ Zitrone (22. August 2020, 10:18).

          Lampen Diogenes hat es begriffen, und ich erachte es so wie er auch als wichtig, daß er es nicht unerwähnt läßt, „für die Richtigkeit“ seiner „ Angaben mal wieder keine Garantie“ zu übernehmen, denn das kann auch niemand von ihm erwarten. Mich würde einmal interessieren, woher er weiß, daß „Goldmann-Sachs und Black Rock ihre Macht bereits an Trump verloren haben“ und ob wirklich „die ganze FED … in der Hand des Präsidenten“ ist. Ich meine, daß selbst bei diesen „Brocken“ immer noch alles möglich ist. Aber vielleicht ist diese Einschätzung nicht richtig. Wer weiß es schon? (…)
          Ich bedanke mich sehr herzlich für den Text. Manche Textstellen halte ich inhaltlich für ein wenig übertrieben, doch sind dafür die anderen Textstellen um so besser.

          @ Zitrone (22. August 2020, 10:46):
          „MMn werden derzeit viele Menschen, in Bezug auf den 29. August, in eine Art Euphorie versetzt, die ihnen eine Lösung nur vorgaukelt. Wirklich drängende Probleme, die außerhalb des Corona-Themas liegen, wie z.B. die illegale Migration, werden von den ganz oben stehenden Querdenker-Köpfen, nie thematisiert.“

          Richtig! Genau das ist neben den Tatsachen Unterwanderung und Plötzlichkeit („Sponti“ läßt grüßen) eine sehr bedeutsame, wenn nicht sogar die bedeutendste Tatsache: die Sprache selbst, d.h. das Medium als das Vermittelnde (gleichgültig, ob in Wort oder Bild), die Rhetorik, die Agitation, das „Feilen“ am Ausdruck – denn damit wird die Masse außer Gefecht, in Angst, unter Terror gesetzt.

          Ich habe hier oft von „Achtundsechzig“ gesprochen, will aber auch hinzufügen, daß ich 1956 geboren bin und deshalb weniger aktiv an „Achtundsechzig“ beteiligt war, es aber damals schon für sehr merkwürdig hielt, daß da junge Leute, Studenten zumeist, für etwas eintraten, das es doch „drüben“ schon längst gab, ich mich also fragte, was sich viele andere auch fragten: „Warum gehen die nicht nach drüben?“

          „Wer zu spät (zum Konservativen) kommt, den bestraft das Leben (des Konservativen)“ – könnte man dazu eigentlich nur sagen, denn selbst dann, wenn damals alle „progressiv“ geworden wären (die meisten sind es ja ihrer eigenen falschen Einschätzung nach), wäre das Leben über sie hinweggegangen, weil das Leben nicht „progressiv“ voranschreitet, sondern in etwa so, wie ein Krebs sich fortbewegt (ein Schritt zurück, zwei Schritte vor). Das Wort „Progressivität“ mochte ich schon zur Zeit der „Achtundsechziger“ nicht, weil ich es mit „Verarschung“ in Verbindung brachte. Und spätestens seit 1990 kann man wissen und sagen: „Ja, Progressivität ist Verarschung“.

          @ Zitrone (22. August 2020, 10:46):
          „Warum?“
          Auch das fing ja bereits mit den „Achtundsechzigern“ an: „ich bin ja gegen Hitler, möchte aber sagen, daß …“; später „ich bin ja gegen Rechtsextreme, möchte aber sagen, daß …“; noch später: „ich bin ja gegen Verschwörungstheorien, möchte aber sagen, daß …“ ….
          (…)
          Die das Querdenken Unterwandernden lenken ab von den Themen der Demonstranten, indem sie deren Themen, hinter denen ja Interessen stehen, ignorieren, eliminieren, permutieren (erst eliminieren, dann umstellen), ganz andere Bezüge herstellen, so daß am Ende wieder das Muster zu erkennen ist, das auch schon damals bei den „Achtundsechzigern“ zu erkennen war. Dabei werden auch Vergleiche angesprochen, die zuletzt nur noch als Gleichungen dastehen, z.B.: „Coronagegner = Verschwörungstheoretiker = Rechtsextreme“ (zumindest aber „Rechte“, wobei wieder eine Gleichung folgt – „Rechte = Konservative = Verschwörungstheoretiker“ -, mit der die Verbindung zur ersten Gleichung (wieder) gegeben ist und „Coronagegner“ folglich doch „Verschwörungstheoretiker“ und „Rechtsextreme“ sind).

          Die Antwort auf Ihre Frage ähnelt somit der, die ich Ihnen am 22.08.2020 um 01:11 Uhr gab: https://fassadenkratzer.wordpress.com/2020/08/20/totale-masken-macht-im-soder-land/#comment-16693 .

        8. @ Hubi Stendahl.

          „Hippie-Veranstaltung“, „Bezahlung“, „Massenbehinderung“, „Friede, Freude, Eierkuchen“, „fehlendes Ziel“.

          @ Zitrone.

          „Kontrollierter Widerstand“, „Neuauflage der 68er Bewegung“, „Faselnganz im Sinne der Neuordner der Welt“, „Menschheitsfamilie“, „paradiesbunte Antifa mit ins Boot holen“, „Anselm Lenz ist unverkennbar ein begeisterter Anhänger der Antifa“, „niemals andere politische Themen ansprechen, wie z.B. den Migrationspakt, tägliche Messerstechereien und Vergewaltigungen von Frauen aller Altersgruppen“, „verschweigen von Themen wie: »The Great Reset«, Event201 …“, „plötzlich wie Phönix aus der Asche auftauchen“, „neue »Love Parade«“.

          Sehr gut beobachtet. Was bleibt: Skepsis, Beobachtung, Urteilsbildung, bei einer Entscheidung dafür: Beteiligung, Zusammenhalt, Feinderkennung.

          Ich habe für manche Redner bei den Demonstrationen Verständnis, weil ich auch vermute, daß sie Angst haben. Mich erinnert diese Situation auch an die Demonstrationen der DDR-Deutschen im Herbst 1989 oder an die der Chinesen auf dem „Platz des Himmlischen Friedens“, die die „Internationale“ sangen, um zu zeigen, daß sie nicht das System stürzen, sondern nur ein wenig Freiheit von ihnen bekommen wollten. So etwas mündet fast immer in Gewalt, oft in Krieg.

          Es gibt aber bei den Demonstrationen auch welche unter den Rednern, bei denen man sogleich, wenn man sie sprechen hört, weiß: das sind Unterwanderer, „Trojapferde“, „Lokomotiven“, die die immer länger werdenden „Züge“ (die immer mehr zunehmende Massen) über andere Gleise und darüber in andere Richtungen als die, die von den Demonstranten vorgesehen waren, lenken sollen.

          Wieviel Geld Soros und seine Kumpels in diesen widerlichen linksrassistischen Pöbel namens „Antifa“, der jede Demonstration auf extreme Weise stört, gesteckt hat, ist immer deutlicher zu sehen.

    3. Endlich mal jemand, der klare Worte ausspricht! Kommt selten genug vor.
      Masken sind ein okkultes Ritual. Masken wurden früher von Sklaven und Gefangenen getragen. Man schaue sich nur mal einen Linienbuss an, der an einem vorbeifährt. Das ist, so sehe ich das, ein Gefangenentransport. Und jetzt denken Sie mal an das okkulte Ritual. Was wird durch die Maske transportiert?

      Ergänzung:

      1.) Vorgestern wurde der Film Plandemic online gestellt, sehr zum Ärger des Deep Staate. Ein Highlight ist ein neues Interview mit Judy Mikovits. Kann man unter anderem hier anschauen:

      https://healthimpactnews.com/2020/plandemic-full-feature-film-released-online-amidst-tremendous-opposition-and-attempts-to-censor-it/

      2.) Brandon Smith (Alt-Market) mit einer Kernaussage „Und so bekommt man Tyrannei, durch schrittweise Verletzungen der persönlichen Freiheiten, bis nichts mehr übrig bleibt“. Man schaue nur nach Australien und Neuseeland. Die psychologische Kriegsführung funktioniert und es gibt keinen nennenswerten Widerstand, weltweit.
      In beiden Ländern hat man übrigens die Bevölkerung entwaffnet und aus diesem Grund meiner Meinung nach bieten diese Ländes ein hervorragendes Testgelände.

      3.) Diese Tyrannei erforder auch eine Veränderung über Konversation mit Covid. Aus Todesfälle wurden Fälle. Ein positiver Test schafft keinen Krankheitsfall. Wie jeder Arzt und Virologe weiß, wird ein „Fall“ erst dann festgestellt, wenn eine Person
      1) einen symptomatischen Ausdruck einer Krankheit hat
      2) Das Vorhandensein eines identifizierten Erregers, von dem bekannt ist, dass er solche Symptome verursacht
      Das bloße Tragen eines Virus ist kein „Fall“.

      Ich empfehle die Lektüre bei Off-Guardian https://off-guardian.org/2020/08/18/bait-switch-how-theyve-changed-the-covid-conversation/

      4.) Armstrong hat klare Worte formuliert in seinem Beitrag „https://www.armstrongeconomics.com/world-news/corruption/the-real-masters-behind-the-scenes/
      Hier wird der Plan kurz und prägnant zusammengefasst: Great Reset und New Green Deal, Klaus Schwab, Soros,Gates, WHO usw.
      Den Artikel kann man bei uncut-news.ch auf Deutsch lesen.

      5.) Die Pläne werden ausführlich hier beschrieben: https://connectiv.events/die-21-ziele-der-illuminaten-und-des-komittees-der-dreihundert/

      Es geht schlicht und einfach ums Überleben! Die Zeit zum Philosophieren ist definitiv abgelaufen!

      1. Es geht schlicht und einfach ums Überleben! Die Zeit zum Philosophieren ist definitiv abgelaufen!
        ——
        Seh‘ ich genau so!
        Auf der Webseite des ‚Great Reset‘
        https://www.weforum.org/great-reset
        wird man mit apokalyptischen Visionen bombardiert. Der WEF-Gründer Klaus Schwab teilt mit:

        „Covid-19 hat gezeigt, dass die alten Systeme nicht mehr für das 21. Jahrhundert geeignet sind. Die Krise hat den fundamentalen Mangel an sozialem Zusammenhalt, Fairness, Inklusion und Gleichheit offengelegt. Jetzt ist der historische Moment, die Zeit, nicht nur das Virus zu bekämpfen, sondern das System für die Post-Corona-Ära zu gestalten.“ (…)

        „Wir stehen am Rande einer globalen Transformation. Alles was wir brauchen, ist die richtige, allumfassende Krise, und die Nationen werden die Neue Weltordnung akzeptieren.“
        – David Rockefeller, US-Großbanker & Politiker

      2. Tja – der isl.m.schen Kleiderordnung gibt das natürlich jetzt auch Auftrieb. – Ist doch noch wegen des Vermummungsverbotes das Tragen des N.kab-Schleiers vor dem Gesicht verboten, sieht man jetzt auch im Freien immer mehr isl.m.sch Gekleidete, die nun die Maske als N.ikab-Ersatz entdeckt haben und das Teil ständig und überall tragen.

    4. @VOODOO

      „Die Behauptungen in diesem Artikel sind teilweise grob falsch.
      Die „Fehlerquote“ von PCR-Tests liegt nicht bei „2 %“, sondern
      bei „96 %“ (Prof. Bhakdi)!“

      Spielt das eine Rolle?

      Bei 2% von 770.000 Tests der letzen Woche; ist nicht einmal die Fehlerquote von 2% = 15.400 als infiziert zusammengekommen. Die richtige Frage lautet also: WAS MISST DIESER TEST EIGENTLICH?

      Drosten hat 2 Sequenzen (Nukleinsäuren) aus einem von Chinesen mit 30.000 Sequenzen gemeldeten „Virus“ als Grundlage für den PCR genommen. Was er dort für die Welt entnommen hat ist vorläufig sein und das Geheimnis der Hintermänner. Kommt heraus, dass der Test nichts nachweist, könnten die Protagonisten einer strahlenden Zukunft entgegen gehen. Warten wir es ab. Die Zeit läuft gegen Drosten.

  20. „In diesem gnadenlosen söderschen Maskenregime herrscht genauso viel Angst vor Denunziation und Bussgeldern wie vor Corona.“

    MUT gehört zum HEILEN, wie ANGSTMACHE zum GELDVERDIENEN AN KRANKHEITEN gehört. Es liegt an jedem Menschen selbst, ob er zu den Hasen oder zu den Jägern gehört.
    Eins fällt mir auf: Jahrhunderte lang waren Europäer Christen, und in Spanien warfen sie die antichristlichen Mauren raus u. retour nach Afrika. Genau andersherum heutzutage, wo man vor lauter Masken nur noch lange Ohren sieht. Muslime holt man auf Steuerzahlers Kosten ins Land.

    Heutzutage haben Europäer andere Lehrer, die sie von Jägern zu Hasen dressieren.

    Und es würde nichts nutzen, auf die Politik zu schimpfen, aber der Politik das Vorrecht zu belassen, Schulen und Hochschulen zu verwalten!
    DAS KÖNNEN WIR PRIVATE BESSER.

  21. Hauptsache Maske!?
    Prof. Dr. Markus Veit, Apotheker und Geschäftsführer der Alphatopics GmbH, Kaufering, einer Beratungsfirma für die pharmazeutische Industrie ist entsetzt!
    Er ist entsetzt über Stellungnahmen aus der Politik und von den Medien und schließlich auch in jüngster Zeit über Urteilsbegründungen zur Maskenpflicht.
    Dieses Entsetzen betrifft auch den undifferenzierten Umgang mit der Thematik seitens der agierenden Kolleginnen und Kollegen.
    Deshalb hat er sich zu nachfolgendem Zwischenruf entschlossen. Er spiegelt seine persönliche Meinung wider, und nach bestem Wissen und Gewissen den derzeitigen Stand der Evidenz.
    https://www.deutsche-apotheker-zeitung.de/daz-az/2020/daz-33-2020/hauptsache-maske

  22. Jeder hat wohl schon einen oder mehrere, wie hier im Artikel beschriebene, Situationen mit der Maske erlebt, die einen nur ratlos zurück lassen ( https://www.nutze-deinen-kopf.de/zwei-maskenerlebnisse/ ).

    Ich bin der Meinung das jeder der die Maske trägt um angeblich seine Mitmenschen zu schützen, die Maske auch zu Hause tragen müsste. Denn zu Hause hat man Kontakt mit den Menschen die einem am wichtigsten sind und die will man doch erst Recht nicht gefährden. Deshalb auch zu Hause die Maske auf. Aber das machen die Maskenträger nicht. Das finde ich schon recht widersprüchlich.

  23. Totale Masken-Macht im Söder-Land
    ————

    Ich zitiere hier Dr. Stefano Montanari , einen Nanopathologen aus Italien, der seit über zwanzig Jahren gemeinsam mit seiner Frau Nano-Pathogene erforscht hat, die sehr winzigen krankheitsverursachenden Teilchen, die typischerweise in der Luft aller überfüllten, verschmutzten, sehr verkehrsreichen Industriestädte sowie Fabriken schweben.
    Das Präfix „Nano“ bezieht sich auf die dramatisch kleine Größe der studierten Objekte. 1.000.000 Nanometer ergeben einen Millimeter. Die Größe des kleinsten für das bloße Auge erkennbaren Teilchens ist 100.000 Nanometer. Daher sind Nano-Pathogene dramatisch klein, obwohl der Schaden, den sie in den Lungen verursachen, umgekehrt proportional zu ihrer Größe ist-

    Die Größe eines Nano-Pathogens liegt zwischen 5 und 200 Nanometer. Wenn man bedenkt, daß ein Virus mit 250 Nanometern als groß betrachtet wird, so haben Nano-Pathogene und Viren (ob Corona oder andere) dieselbe Größenordnung.

    Dr. Stefano Montanari:
    …“Was die Masken betrifft… sie sind nutzlos. Es gibt Millionen, Milliarden Viren auf jedem Quadratmeter der Erde, auf dem Gehsteig und so weiter. Es ist eine Illusion, die aus der (imaginierten) Vorstellung folgt, daß Viren so groß wie Kanalratten sind. Eine Vorstellung, die vielleicht aus den Worten von Signorina Lorenzin entstand, die, als sie Gesundheitsministerin war, sagte, daß Viren herumkriechen und springen (als ob sie Tiere wären).

    Viren existieren in enormen Mengen und können in enormen Mengen in die Zellen eindringen, die einen Durchmesser von ein paar Tausendstelmillimeter haben. Eine Maske zu tragen, ist wie ein Tor aufzustellen, um Moskitos am Eindringen ins Haus zu hindern.“ (…)

  24. Söders Frau verkauft Mund-Nasen-Masken (MNM). Alles klar?

    Die US-Politiker haben sich schon abgesichert. In den USA ist nämlich schon per Gesetz geregelt, daß für die gesundheitlichen Schäden der US-Staat bzw. die US-Staaten nicht in Haftung genommen werden darf. Ganz nüchtern betrachtet bedeutet das zweierlei: (1.) Diese Geldgierigen gehen von einer Zwangsimpfung aus; (2.) sie gehen von gesundheitlichen Schäden enormen Ausmaßes aus, und zwar so enorm und in einer so hohen Anzahl, daß sie sich selbst schon bedroht fühlen.

    1. @ Kathrina:

      „Söders Frau verkauft Mund-Nasen-Masken (MNM). Alles klar?“

      Ja, Kathrina. Söders Geldgier ist der Grund für die strengen Vorschriften in Bayern. Söder macht ein Riesengeschäft mit dem Verkauf von MN-Masken – allerdings nur dann, wenn MN-Masken auch getragen werden. Also wird Söder nicht so schnell aufhören mit seinem „Maskenball“. 😉

  25. Hat sich schon jemand gefragt, warum die Deutschen immer noch nicht auf der Gass´sind?
    Liegt es vielleicht daran, dass die Kinder und Enkel der alten weißen Männer jeden anderen als Außenstehenden betrachtetn, zudem zunehmend narzißtisch geprägt sind und Egomanie in seiner Vollendung feiern? Wie will man auch sonst im Raubtierkapitalismus überleben?
    In so einem Konglomerat von vielen Egozentrikern ist fast keiner bereit für die Allgemeinheit etwas zu tun. Ja man schützt nicht einmal seine Kinder vor dieser Maskenwut, läßt sie lieber hinter der Maske verrecken, weil Maske ja so wichtig ist um sich und andere zu schützen. Meine Noch-Pastorin schrieb mir bzgl Maskentragen und Abstandsgebot:

    „Jesus ruft uns Menschen zur Verantwortung in dieser Welt (vergl Mt 25,31 – 46) Sich dieser Pflicht (Maskentragen und Abstand halten) zu entziehen ist nicht nur lieblos und leichtfertig, sondern auch ein Verbrechen an Gott, der uns unser Leben anvertraut hat.“

    Jetzige Ärzte therapieren nur nach Pharmagutdünken mit Masken. Denn wenn sie es nicht täten, gäbe es Druck von oben bis zur Aberkennung der Approbation.
    Polizisten müssen um ihren Job fürchten, wenn sie den Mund aufmachen. In den meisten Firmen ist Obrigkeitsdenken angesagt. Wer aufbegehrt, verliert seinen Job. Das Bodenpersonal der Kirchen wagt auch nicht aufzubegehren etc.
    Also – alle kuschen um der Eigenliebe und Fürsorge Willen. Schließlich braucht man seinen Job und danach die große Sintflut.
    Mit solchen Menschen kann man keine Änderungen mehr herbeiführen.

    1. Sich auf Jesus zu berufen um Maulkorb-Verweigerer eines Verbrechens an Gott zu bezichtigen ist eine Ungeheuerlichkeit an Anmaßung.
      Mit dem Mißbrauch des Namens des Heilands zieht sie sich aus meiner Sicht sogar den Zorn Gottes zu und darf darum eine Strafe erwarten.

      1. Sich auf Jesus zu berufen ist besonders die Sache der anti-Christen, die nicht fähig oder willens sind, Unterschiede zu begreifen. Christus ist das Geistwesen, das bei der Jordantaufe des schon ca. 30 jährigen Jesus(!) in dessen materiellen Körper stieg.
        Jesus hat eine irdische Mutter und einen irdischen Vater.

        Christus spricht: Ich und der Vater sind eins. (Johannes 10-30) Christus stammt nicht von irdischen Eltern ab, sondern irdische Eltern stammen von Ihm ab.

        Wenn er durch Joh. 8:32 von der Erkenntnis der Wahrheit spricht, die uns frei macht, dann müssen wir unterscheiden zwischen Erkenntnis und Glauben. Der Glauben, von dem diese Pastorin spricht, macht uns unfrei, und die Erkenntnis der Wahrheit, auf die uns Christus hinweist, macht uns frei.

        1. Christus = Messias = der Gesalbte.

          Im Altertum wurden die Könige durch Salbung in ihr Amt geweiht.

          Ihre Ansicht, daß Jesus durch die Taufe zum Heiland wurde, teile ich, denn auch ich bin der Auffassung, daß dabei der Geist des Urgrundes allen Seins (Gott) in den Menschensohn Einzug hielt.
          Wie ich zu dieser Meinung kam?
          Der Parakletos hat es mir geflüstert.

          Wünsche allen geneigten Lesern ein gesegnetes Wochenende!
          🙂

      2. @Kosmokrat schrieb: „Sich auf Jesus zu berufen um Maulkorb-Verweigerer eines Verbrechens an Gott zu bezichtigen ist eine Ungeheuerlichkeit an Anmaßung.“

        Zitat:
        Da hilft kein Zorn. Da hilft kein Spott.
        Da hilft kein Weinen, hilft kein Beten.
        Die Nachricht stimmt! Der liebe Gott
        ist aus der Kirche ausgetreten.“
        (Erich Kästner, aus: „Neues vom Tage“)

        Ob die das schon wissen, die Kuttenträger?

        1. @ Vier:
          „Zitat:
          Da hilft kein Zorn. Da hilft kein Spott.
          Da hilft kein Weinen, hilft kein Beten.
          Die Nachricht stimmt! Der liebe Gott
          ist aus der Kirche ausgetreten.“
          (Erich Kästner, aus: „Neues vom Tage“)

          Ob die das schon wissen, die Kuttenträger?“

          Meinen Sie die Jungs aus dem Motorradclub? Bei den kirchlichen Kuttenträgern müßten wir unterscheiden zwischen Ober-, Mittel- und Unterschicht. Die Oberschicht hat es immer schon gewußt, die Mittelschicht wahrscheinlich auch, aber die Unterschicht wohl eher nicht, zumindest nicht alle ihre Angehörigen.

          Um dem Thema hier noch näherzukommen, müßte in dem Gedicht das Wort „Gott“ durch das Wort „Herrscher“ und das Wort „Kirche“ durch Wort „Menschheit“ ersetzen.

    2. Eva Scherrer

      „Jesus ruft uns Menschen zur Verantwortung in dieser Welt“

      Dann sollte man seinen Erkenntnissen und nicht den vernebelnden Interpretationen satanischer Cliquen wie dem Katholizismus oder Protestantentum folgen.

      Jesus sagte klar und deutlich:

      „Die Pharisäer (Politiker, Pfaffen und Finanzoligarchie) und Schriftgelehrte (Wissenschaftler) haben die Schlüssel der Erkenntnis empfangen und haben sie versteckt. Selbst sind sie nicht hineingegangen aber sie ließen auch nicht hineingehen, die hineingehen wollten. „(Th Ev. Log.39)

      In der Feldpredigt macht er doch deutlich, wie man einem Angriff eines Feindes begegnet; es wird nur bewusst falsch mit „Feindesliebe“ übersetzt. In Wahrheit sagt er metaphorisch, dass man statt dem Impuls der Rache bzw. des gewalttätigen Widerstands zu folgen, einfach nicht mitmachen sollte, wenn Unrecht geschieht. Stattdessen könnte man den Schergen (Polizei, Pfaffen und Verwaltung) Blumen zur Demo mitbringen (die Wange hinhalten). Ohne Masken selbstverständlich, denn sie sind Unrecht. Diesem Unrecht folgt man nach der Idee des Nazareners NIEMALS. Das sollten Sie der als Pfarrer*in😂 verkleideten Satanistin ohne sich dessen bewusst zu sein, deutlich machen, bevor Sie aus dem Verein austreten. Denn sie glaubt ganz offensichtlich an die Notwendigkeit von Unterdrückung, die konträr zur Lehre des Nazareners steht.

      „Die Wahrheit wird euch frei machen“(Johannes 8,31-32), sagt Jesus.

      Aber die Pharisäer haben bis heute die Schlüssel und teilen sie mit Pfaffen, Finanzjongleuren und Politikern. Ein Christ hätte daher im Sinne der Bergpredigt und Feldrede die Pflicht, das derzeitige Unrecht nicht mitzutragen.

      1. Ob man die Blume oder die Wange hinhält ist einerlei, wenn der Unrechttuende mangels Gewissen oder von Bösembesessensein das Unrechte seines Tuns nicht erkennen kann oder will.
        Und die Menschheit ist erwiesenermaßen auch nicht gleichermaßen mit Abstraktionsfähigkeit und Empathie ausgestattet. Heute noch weniger als vor Jahrhunderten.
        Und es wird ja auch hart daran gearbeitet, dem Menschen das Menschliche zu nehmen und ihn auf das rein Biologische zu reduzieren durch Chemtrailing / Vergiftung, Glykosat, G5 und andere Mikrowellen, Genmanipulation und biologischen Waffen sowie mentaler Vergiftung durch die Medien.

  26. Ja, dann haben wir ja eine „rosige“ Zukunft vor uns. Die Fremden hassen sie, die angeblich Oppositionellen aus dem eigenen Volk hassen sie auch (fein nach Frankfurter bzw. „68er“ Manier). Fazit für all diese Linken: In diesem Land wird sich nichts mehr ändern, weil wir – die Antifa und die Antiantifa – es so wollen. Der angebliche Widerstand gegen globale Maskerade und Antifa macht mit bei deren Unterdrückungssystem, verstärkt es sogar.

  27. @ Kathrina.

    Ich kann Sie trösten, Kathrina. Vom Volk ist sowieso noch nie „Revolution“ ausgegangen, auch nicht bei der „französischen“ oder „russischen“, denn alle „Revolutionen“ sind vom Geld bezahlt gewesen und haben immer nur zu noch mehr Geld und Macht auf der Seite derer geführt, die diese „Revolutionen“ bezahlt haben. Bei der angeblich „französischen Revolution“ hatten spätestens seit Robespierres Terror der Geldadel (die Hochfinanz, Finanzmafia) Frankreich so fest im Griff wie nie zuvor und er hat es auch seitdem nicht mehr wieder losgelassen, auch nie wieder loslassen müssen, weil sich sowieso nichts dagegen regte in der „Grande Nation“. Und bei der angeblich „russischen Revolution“ war es auffallend ähnlich.

    Der Geldadel wird selbst bald in große Probleme kommen. Aus seinen eigenen Reihen heraus. Trump könnte ein Vorbote dessen sein. Die Geschichte wird es zeigen.

    1. @ Herr Schütze.

      Man möchte sich aber manchmal auch ganz gerne bestätigt sehen. Sehen Sie das nicht so, Herr Schütze? Wenige Trolle kann ich noch ganz gut ignorieren, aber wenn die überall sind, in allen Medien, im alltäglichen Leben und überall auf der Welt, dann könnte ich manchmal auch an die Decke gehen.

      1. In Troll-Land sind die Trolle zu Hause.
        Ähnlichkeiten mit dem Michel-Land sind da nicht zufällig.

        Um das zu verstehen, hier die letzte Folge der Reihe „Die Abenteuer des Kapitän Brühmichel“ :

        Nachdem sein Schiff also gekentert ist, weil er zielführend sämtliche Warnungen ignorierte, ihre Überbringer beschimpfte und ihnen mit Steinigung drohte, hat er endlich wieder festen Boden unter den Füßen bekommen und steht nun „felsenfest“ auf der Decke des Brückenraums zwischen den Lampenreihen. Alles hat dicht gehalten und das Licht funktioniert glücklicherweise noch!

        „Ha“, platzt es siegesgewiß aus ihm heraus. „Qualität Made in Germany!“
        (Ein selbstsicheres Lächeln huscht über sein Antlitz.)

        Mit stolzem Kopfwackeln über diesen unverdienten Gewinn und der Gewißheit, daß ihn gerade niemand sieht, nimmt er endlich die durchfeuchtete Maske ab, dabei er denkt: „I can’t breathe.“
        Prompt geht er hin und macht ein Fenster auf …

      2. @ Herr Schütze:

        „Der Geldadel wird selbst bald in große Probleme kommen. Aus seinen eigenen Reihen heraus. Trump könnte ein Vorbote dessen sein. Die Geschichte wird es zeigen.“

        Zitat: „ Die jeweils Machtausübenden wollen jedoch auf das Wort Demokratie und die Vorteile einer geeignet gestalteten Demokratie nicht verzichten, weil sie eine besonders wirksame und vergleichsweise kostengünstige Form der Revolutionsprophylaxe darstellt.“ R. Maisfeld aus „Angst u. Macht“

        Zit.: „Wenn die Kosten der Repression zu hoch sind und die Versprechen von Zugeständnissen nicht glaubwürdig sind, können Eliten gezwungen sein, Demokratie zu schaffen.“ Acemoglu & Robinson (205, S.293)

        Zit.: „Zudem hat eine Demokratie aus Sicht der Machtausübenden den Vorteil, dass sie Prozeduren anbietet, durch die gewalttätige Konflikte zwischen Elitegruppierungen mit unterschiedlichen Interessen vermieden werden können.“ R. Maisfeld aus „Angst u. Macht“- abgeholt bei Marx..

        Mit der „Energiewende“ in Deutschland scheint Merkel vorerst eine derartige konfliktverhindernde „Prozedur“ gelungen zu sein. Die „Erneuerbaren“ wurden mit Geld genauso überhäuft, wie die abzulösende Atomenergie und die C02- produzierenden Energieträger- respektive deren EIGENTÜMER. Und die Herde der dt. Schafe darf beide Elitegruppen mit exorbitanten Steuern, Abgaben sowie Energiepreisen bezahlen.

        Folgt man der Essenz der obigen Zitate, hat die „Vasallen-Merkel-Demokratie“ indes langfristig versagt, da es ihr nicht gelang, sich im Machtkampf der transatlantischen Eliten gleichzeitig beiden, miteinander konkurrierenden, Seiten anzudienen und diesen wirksam zu dienen. Der Atom-Physikerin ist es nicht gelungen, das Einstein-Podolsky-Rosen-Paradoxon (Teilchen-Verschränkung) in ihre Politik zu übertragen. Sie hat sich inkl. des ganzen dt. „System-Klüngel“ gegen die „Gruppierung Trump“ und für Hetze entschieden- und dies scheint sich nun zu rächen.

        Durch den unsäglichen „Maulbindenerlass“ im „Corona-Schwindel“ hat sie einen nächsten schweren Fehler begangen. Sie hat damit die Bedingungen für eine (dankbar gelenkte?) „Graswurzelbewegung“ im „Querdenken“ geschaffen, die am 29.8.2020 in Berlin auf eine Flutwelle ansteigen kann…siehe hier:
        Zitat:„29.8.2020 – Stürzen Querdenker die Regierung?“
        https://www.journalistenwatch.com/2020/08/21/stuerzen-querdenker-regierung/

        1. De facto haben wir keine Volksherrschaft (Demokratie) sondern eine Parteien- bzw. Meinungsdiktatur.

          Das unentwegte Geplärre von Demokratie ist aus meiner Sicht nur Demokratismus und dient den Herrschenden zur Ablenkung des Volkes von den tatsächlichen Verhältnissen.

          Im Übrigen bin ich ein Befürworter von Aristokratie im eigentlichen Sinne (Herrschaft der Besten), sowie der Monarchie. Einen gewählten König habe ich bereits. Dieser ist für mich der Allerbeste.
          🙂

        2. Ohje- mein Fehler, ich versäumte „Demokratie“ zu definieren. Eine Beschreibung hier:

          „DEMOKRATIE als der Deckname für den planetarischen Schwindel. Dieses Wort ist so lügenhaft, daß es nicht einmal gilt, wenn man darunter die Pöbelherrschaft von unten versteht; denn auch diese ist bloßer Schein, innerhalb des Imperialismus der Diktatur der Funktionäre des losgebundenen Willens zum Willen als der unbedingten Machenschaft.“Zit. Martin Heidegger

      3. @ Kathrina: „@ Herr Schütze. Man möchte sich aber manchmal auch ganz gerne bestätigt sehen. Sehen Sie das nicht so, Herr Schütze? Wenige Trolle kann ich noch ganz gut ignorieren, aber wenn die überall sind, in allen Medien, im alltäglichen Leben und überall auf der Welt, dann könnte ich manchmal auch an die Decke gehen.“

        Das sehe ich schon genauso wie Sie, Kathrina, möchte jedoch auch auf das Vertrauen auf Gott hinweisen.

        „Trojanische Pferde“, die Sie „Trolle“ genannt haben, gab es immer schon in der Geschichte, also gibt es sie auch heute und wird es auch in Zukunft geben. Die Zukunft ist ja auch Geschichte, nur ist sie noch nicht oder nur auf eine Weise, die der Wettervorhersage ähnelt, erzählt worden.

        Ich gehe von einer Gelegenheit für uns aus, nach der es gegenwärtig zwar nicht aussieht, die sich aber bald zeigen wird, weil vom Plan her nicht vorgesehene Fehler auftreten werden. 🙂

  28. Von Helmut Oberth sollen folgende Worte stammen: “ ……………………………Das ethische Durchschnittsniveau einer Gesellschaftsschicht wird um so schlechter, je besser und einflußreicher sie gestellt wird. Dieser Umstand mag erklären, warum die Welt nicht schon seit 5000 Jahren ein Paradies ist.“

    Wo und wann auch immer eine Gesellschaft mit psychischer Gewalt und den Gesetzen einer menschlich entfremdeten autoritären Klasse gezwungen wird, sich zu unterwerfen,sind es die Wissenschaften, die von jener menschlich entfremdeten autoritären Klasse scharf zensiert wird. Den Mitgliedern genannter Klasse fehlt es an genau den „Qualitäten“, die es menschlichen Wesen gestatten, in Frieden und sozialer Eintracht zu leben. Sie sind aus medizinischer Sicht Charakteropathen, genauer – Sozio- und Psychopathen. Und sie haben allen Grund, die Wissenschaft derart zu reglementieren, dass ihre „Persönlichkeitsstörungen“ nicht zur Diskussion stehen .

    Wenn ein „normaler“ Mensch eine Entscheidung trifft, unmoralisch, veranwortungslos, unanständig oder grob egoistisch zu handeln, meldet sich sein Gewissen. Genau dies fehlt vorgenanntem Personenkreis . Sie plündern unsere Bankkonten, unsere Beziehungen und unser Selbstwertgefühl aus und zerstören wo immer es ihnen zur Durchsetzung ihrer Pläne notwendig erscheint, den Frieden.

    Laut Lobaczewski wird eine Gesellschaft, die von Psychopathen regiert wird, nach und nach korrumpiert. Die „psychopathische Kaste“ wird versuchen, die intellektuelle Schicht dieser Gesellschaft zu unterwandern, sie zu Mitläufern zu machen, was bereits global und umfangreich geschehen ist.. Solch Mitläufer finden wir fatalerweise inzwischen in allen Gesellschaftsschichten , was wenig Hoffnung auf einen friedlichen Ausgang der Krise läßt, in der wir uns befinden.

    1. Es gibt immer einen Grund zu hoffen. Wie wäre es denn mit individueller Souveränität?

      Souveränität ist die uneingeschränkte Entscheidungsfreiheit in inneren und äußeren Angelegenheiten.
      Die Freiheit der Selbstbestimmung aus Selbstbesinnung ist die Voraussetzung für die Freiheit zu tun und zu lassen, was man für richtig hält.

      Das Individuum ist von Natur aus frei. Wählt es einen Abgeordneten, eine Partei oder eine Bewegung, gibt das Individuum einen Teil seiner Entscheidungsfreiheit an (fremde) Leute ab, die dann in seinem Namen entscheiden.
      Der Wähler hat damit in gewisser Hinsicht buchstäblich seine Stimme abgegeben, hat diesbezüglich nichts mehr zu sagen und sich folglich selbst in eine relative Unfreiheit begeben.

      Ist der Wähler mit den Entscheidungen der von ihm Gewählten nicht zufrieden, kann er seine Souveränität zurückerlangen, indem er einfach bei der nächsten Wahl seine Stimme behält.
      Wenn den Demagogen die Wähler auf diese Weise scharenweise davonliefen, stünden sie schließlich vor leeren Stühlen sowie auf leeren Plätzen, niemand würde ihnen mehr zuhören und die Macht wäre ihnen wie Wasser durch die Finger geronnen.

      1. Das sehe ich ganz genauso. Es macht auch wenig Sinn, neue Parteien zu gründen, denn sie würden wieder von denselben Leuten unterwandert, die gewissenlos um des Geldes willen an die Spitze kriechen, die gestützt werden von denselben Kreaturen. Ich bin mir sicher, daß alle, die jetzt das Sagen haben, irgendwie erpreßbar sind, sein müssen, sonst wären sie von den über ihnen Stehenden nicht lenkbar. Wer sich da oben widersetzt, wird einfach umgebracht. Besser als in dem Link von Elisa ganz oben „Die gekaufte Pandemie“ kann man das System nicht beschreiben. Peter Haisenko ist wieder ganz groß!!!!
        Der Ausweg ist daher wirklich die Verweigerung. Man kann gegenleben. Nun kann man jammern, daß es zu wenig tun, aber der erste Schritt (bei sich anzufangen) ist die Nähe zum Ziel. Ich habe hier im Ort die Leute alle nicht statt dem bekloppten „Hallo“, sondern „Guten Morgen, Tag, Abend“ gegrüßt,und es gibt kein „Hallo“ mehr. Ist natürlich belanglos, aber so geht Vorbildwirkung.

      2. ZITAT @ Till Aussenspiegel:
        „Wenn den Demagogen die Wähler auf diese Weise scharenweise davonliefen, stünden sie schließlich vor leeren Stühlen sowie auf leeren Plätzen . . . “

        DIESES von Ihnen beschriebene Szenario beobachten wir seit den 70’er Jahren sowohl in den christlichen Kirchen, als auch in der westlichen Politik, durch sinkende Wahlbeteiligung & immer extremere Versuche der Polit-MAFIA, um mit ALLEN Mitteln trotzdem an der Macht zu bleiben!

        Der Flucht der Gläubigen & der Wähler setzen die amtlichen VERLIERER seitdem GEHEIME, weil ILLEGALE Methoden wie PSYCHO-KRIEGE & zuletzt eben BIO-KRIEGE wie den Corona-BETRUG entgegen!

        Gegen die seit rund 50 Jahren immer KRIMINELLER werdenden Methoden der amtlichen VERSAGER – die immerhin UNBEGRENZT über UNSER Geld, das Gewalt-Monopol, die Polizei, die Armee & besonders die diversen GEHEIMEN „Dienste“ verfügen, und nicht zuletzt auch die angeblich „freien“ MEDIEN „gekauft“ haben, wie Dr. Udo Ulfkotte in seinem Bestseller: „Gekaufte Journalisten“ bewiesen hat – hilft nur die hoch professionelle AUFKLÄRUNGS-ARBEIT von uns allen als zivile KRIMINALISTEN, die aus Erfahrung wissen, wie Psychopathen & Kriminelle ticken, und wie Kriminelle IMMER versuchen, ihre LÜGEN & ihre Spuren zu verwischen!

        Nicht von ungefähr wird inzwischen bei fast jeder angeblich freien, demokratischen Wahl – im Handumdrehen immer häufiger auch von Wahl-Fälschung gesprochen – und echte Profiler wissen, das echte Psychopathen unter anderem immer auch die FALSCHEN, ihrer EIGENEN Verbrechen beschuldigen . . .

        Doch JEDER echte Verbrecher & JEDES Verbrechen hinterläßt Spuren!
        An dem Tage, wo wir uns ALLE miteinander auf das SUCHEN & FINDEN von echten BEWEISEN konzentrieren – werden DANK unserer Augen & Ohren, DANK Handy-Kameras & Handy-Mikrophonen – immer mehr ECHTE Verbrechen unserer angeblich gewählten Regierungen entdeckt & DOKUMENTIERT, und kommen ganz am Ende auch zur ANKLAGE!

        WAS ein einziges Handy-Video bewirken kann – das hat der Tod von George Floyd durch seinen Arbeits-Kollegen & Polizisten Derek Chauvin, aus dem SELBEN Nachtclub in Minneapolis, mit der explosionsartigen Entwicklung der „Black Lives Matter“-Bewegung (BLM) BEWIESEN.

        1.) GROSSVERANSTALTUNGEN in fast allen Ländern der Erde – OHNE Maske & OHNE „social distancing“ sind völlig harmlos – was die Infektions-Gefahr mit SARS-CoV-2 / Covid-19 angeht! (Aber NUR, wenn es den perfiden Zielen der kriminellen Globalisten-Sekte dient!)

        2.) Ein EINZIGES Handy-Video kann eine Art Welt-Revolution auslösen – WENN DIE AMTIERENDE MACHT ES GEKONNT EINSETZT – echte Aufklärer-Videos erkennt man meistens sofort daran, daß sie vorsätzlich VERSCHWIEGEN, ZENSIERT und/oder in den gekauften Staats-Medien mit dem CIA-KAMPF-BEGRIFF „Verschwörungstheorie“ lächerlich gemacht werden.

        HIER hat sich die mit dem Rücken zur Wand kämpfende Globalisten-Sekte SELBST ausgetrickst – wir sollten also JETZT mehr denn je am Ball bleiben – wenn sie im Herbst die neuen Viren auf die den Verbrechern wichtige „HOTSPOTS“ verteilen & die neue PANIK ausrufen, um mit ihrem, die GENE manipulierenden IMPF-TERROR, die perfide Ernte ihres BIO-KRIEGES einfahren zu wollen. Denn SARS-CoV-2 / Covid-19 ist nur der bisherige Höhepunkt einer GEHEIMEN Kette von BIO-KRIEGEN & BIO-TERROR unserer Regierungen & des Tiefen Staates dahinter, gegen die Menschen & gegen die Menschen-Rechte, wie Sie HIER dokumentiert sind, zum SELBST studieren & SELBST nachdenken!

        Klicke, um auf Ist%20das%20Corona-Virus%20eine%20biologische%20Waffe.pdf zuzugreifen

    2. ZITAT @ erwinlottermann:
      „Laut Lobaczewski wird eine Gesellschaft, die von Psychopathen regiert wird, nach und nach korrumpiert. Die „psychopathische Kaste“ wird versuchen, die intellektuelle Schicht dieser Gesellschaft zu unterwandern. . . “

      WER Lobaczewski zitiert, sollte zu aller erst Hubbard’s bahnbrechendes Werk zu „psychosis“ kennen & verstehen – denn Hubbard liefert nicht nur die mit Abstand präziseste Diagnose, sondern auch die funktionierenden tools & Techniken, um ECHTE Psychopathen zielsicher zu identifizieren & von nur „infizierten“ Mitläufern zu unterscheiden – und der ECHTE Test ist immer die tatsächliche Heilung der Situation, und falls gewünscht, auch die Heilung des geisteskranken Psychopathen. . . !
      Leider sind ECHTE Psychopathen meist MENTAL derart weit abgedriftet, daß sich derart am Geiste erkrankte Personen – SELBST für die einzig „normale“ Person im Raume halten – und sich selbst sogar für ALLE anderen völlig offensichtliche Fehler eben NICHT eingestehen können, was natürlich die ERSTE Vorraussetzung einer möglichen Heilung ist!

      Bei Adolf Hitler – wurde DIESE totale Verschiebung der sieben Sinne, also der eigenen Wahrnehmung – am Ende sogar den meisten Laien deutlich!

      BILD würde schreiben:
      „Psychopathen haben immer RECHT!“
      Genau DARAN erkennt man sie – besonders wenn das von ihnen angerichtete UNRECHT schließlich überdeutlich wird – und die DISKREPANZ zwischen Reden & Taten immer „verrückter“ wird.

      Es gibt aber KEINEN GRUND für Depressionen – denn genau DIESER Sachverhalt wird im Laufe der Corona-Betrügereien immer KLARER – und am Ende werden uns geistig gesunde Profis wie Dr. med. Wolfgang Wodarg & Dr. med. Bodo Schiffmann & unsere inzwischen 700 Ärzte für Aufklärung mit erstklassigen BEWEISEN wieder auf den festen Boden der Realität zurück führen, zumal jetzt endlich auch die Juristen beginnen aufzuwachen. . .

  29. @ Erwin Lottermann:

    „Von Helmut Oberth sollen folgende Worte stammen: »Das ethische Durchschnittsniveau einer Gesellschaftsschicht wird um so schlechter, je besser und einflußreicher sie gestellt wird. Dieser Umstand mag erklären, warum die Welt nicht schon seit 5000 Jahren ein Paradies ist.«“

    Folgendes besonders zum zweiten Satz aus dem Zitat: Rousseau und nach ihm der Kommunismus haben ihre Gläubigen auf diese Weise gefischt. Selbst dann, wenn man vor den Zeitraum vor 5000 oder 6000 Jahren zurückgeht und von dort aus einen Neustart hinlegen will, wird dieser scheitern, und zwar immer wieder und immer wieder nach ersten Versuchen, mit denen es zu klappen scheint, sich aber später wieder herausstellt, daß es doch nicht klappt.

    Die Menschen sind leider schon aus rein anthropologischen Gründen nicht dazu geeignet, ein Paradies zu schaffen. Sie stehen sich dabei immer wieder selbst im Weg.

    Schade. 😦

    1. Von einer geistigen Perspektive wird die Menschheit von höheren Wesen auf einen Entwicklungsweg gebracht, auf dem es nicht das Ziel ist, ein irdisches Paradies zu schaffen, sondern sich immer wieder in einem physischen Leib zu inkarnieren, um in der zunächst unbewussten, dann immer bewusster werdenden Auseinandersetzung mit bösen Mächten immer neue Kräfte auszubilden.
      Es ist unmöglich, aus der rein irdisch-materiellen Perspektive den Sinn des Erdenlebens und der Entwicklung der Menschheit zu verstehen.
      Rudolf Steiner bietet da als Eingeweihter in die höheren Welten Erkenntniswege und Perspektiven. Man darf nur in seinem Erkenntniswillen nicht erlahmen und sich in der prüfenden Auseinandersetzung den Zugang durch mitgebrachte Vorurteile nicht selbst verbauen.

      1. @ Herr Ludwig:

        „Von einer geistigen Perspektive wird die Menschheit von höheren Wesen auf einen Entwicklungsweg gebracht, auf dem es nicht das Ziel ist, ein irdisches Paradies zu schaffen, sondern sich immer wieder in einem physischen Leib zu inkarnieren, um in der zunächst unbewussten, dann immer bewusster werdenden Auseinandersetzung mit bösen Mächten immer neue Kräfte auszubilden. Es ist unmöglich, aus der rein irdisch-materiellen Perspektive den Sinn des Erdenlebens und der Entwicklung der Menschheit zu verstehen.“

        Wenn ich von „anthropologischen Gründen“ spreche, meine ich nicht die „rein irdisch-materielle Perspektive“ allein , denn sonst hätte ich von „anthropologischen Ursachen“ (anorganisch) oder „anthropologischen Trieben“ (organisch) nur gesprochen, doch ich meine ja mit den „anthropologischen Gründen“ auch die „seelischen Motive“ und besonders die „geistigen Gründe“, und zwar – genau gesagt – diejenigen geistigen Gründe, die auf die anorganischen Ursachen, die organischen Triebe, die seelischen Motive und wieder auf die geistigen Gründe zurückwirken. Darum habe ich das Wort „Gründe“ (und eben nicht die Wörter „Ursachen“, „Triebe“, „Motive“) benutzt.

        Die Ausbildung der über die Auseinandersetzung mit bösen Mächten sich erneuernden Kräfte ist ein sowohl religiöses (die Übung betreffendes) als auch ethisches Thema. Es muß dafür auch zuvor ein Verständnis eingeübt worden sein. Nur sehe ich dieses Verständnis mehr auf dem Gebiet der Empirie und Logik als auf dem Gebiet des Religion und Ethik.

        @ Herr Ludwig:

        „Rudolf Steiner bietet da als Eingeweihter in die höheren Welten Erkenntniswege und Perspektiven.“

        Ich habe mit Thomas R. E. Lentze, der Steiners „Erkenntniswege und Perspektiven“, wie Sie sagen, sehr gut kennt, in seinem Reserveforum auch über Steiner gesprochen. Siehe: https://Reserveforum.de .

        Wir haben uns nicht immer einigen können, aber immer gut vertragen.

        @ Herr Ludwig:

        „Man darf nur in seinem Erkenntniswillen nicht erlahmen und sich in der prüfenden Auseinandersetzung den Zugang durch mitgebrachte Vorurteile nicht selbst verbauen.“

        Das ist richtig. In der Wissenschaft, von der ich eigentlich komme, nennt man diesen, für mich sehr hohen Wert „Objektivität“ (man soll die Subjektivität bei der Erkenntnis abgeschaltet lassen), im Alltag oft „Neutralität“ oder „Unvoreingenommenheit“, „Vorurteilslosigkeit“ genannt.

  30. @ Erwin Lottermann:

    „Die »psychopathische Kaste« wird versuchen, die intellektuelle Schicht dieser Gesellschaft zu unterwandern, sie zu Mitläufern zu machen, was bereits global und umfangreich geschehen ist. Solch Mitläufer finden wir fatalerweise inzwischen in allen Gesellschaftsschichten , was wenig Hoffnung auf einen friedlichen Ausgang der Krise läßt, in der wir uns befinden.“

    Schon die Vorläufer der heutigen Globalisten unterwanderten die intellektuelle Schicht im Abendland. Auch sie schon gaben sich als Liberalisten, Egalitaristen (Kommunisten), Fraternitaristen (Humanitaristen) und ähnliche Isten aus, wurden zumeist auch als solche verstanden, hatten aber immer nur, wenn es um die Intellektuellen ging, den Gedanken „Unterwanderung“ im Kopf. Im Abendland begann diese Unterwanderung noch vor der französischen „Revolution“, mit der sie in Frankreich sich fest etablieren konnte, und zwar trotz der Tatsache, das es auch Gegenwehr gab – bis etwa 1871 (als wieder eine „Revolution“ diese Gegenwehr beendete, diesmal für immer) -, die aber nicht mehr erfolgreich sein konnte. In Deutschland setzte die Unterwanderung zur selben Zeit ein wie im restlichen Westeuropa, konnte sich aber vor 1918 noch nicht durchsetzen, wurde also erst 1918 erfolgreich – und wieder mit einer „Revolution“. Man kann daher fast sicher sein, daß Unterwanderer auch schon die englische „Revolution“ von 1688 für sich nutzten, um sich in England zu behaupten. Immer dann, wenn von „Revolution“ gesprochen wurde und wird, war und ist Unterwanderung durch Geist und Geld die Ursache, wie auch Herr Schütze schon gesagt hat. Ein Beispiel aus jüngerer Zeit: Auch „Achtundsechzig“ ist ja besonders von den Intellektuellen als „Revolution“ bezeichnet worden, und daß diese Intellektuellen unterwandert, von der Frankfurter Schule beeinflußt waren und sind, ist bekannt.

    Heute ist es nach meiner Einschätzung bereits so, daß die Jungintellektuellen eine der Unterwanderung ähnelnden Beeinflussung bereits seit ihrer Zeit im Kindergarten ausgesetzt sind. Das paßt auch symbolisch zu deren permanenten Gebrauch von Mobiltelefonen, Internet u.ä. sowie einer „Meinung“, die wie Kleidung von einer mittlerweile ebenfalls völlig unterwanderten Mode gelenkt wird.

    1. Das liegt meiner Einschätzung nach an mangelnden Tugenden.
      Tugend kommt von taugend. Wer keine Tugenden hat, taugt nichts.
      Wer sich dagegen Tugenden aneignet und sie pflegt, erwirbt sich in Bezug auf den sittlichen Verfall der Massen eine geistige Immunität.

      1. ZITAT @ Kosmokrat:
        „Wer sich dagegen Tugenden aneignet und sie pflegt, erwirbt sich in Bezug auf den sittlichen Verfall der Massen eine geistige Immunität.“

        BINGO!

      2. @ Kosmokrat: „Das liegt meiner Einschätzung nach an mangelnden Tugenden. Tugend kommt von taugen. Wer keine Tugenden hat, taugt nichts. Wer sich dagegen Tugenden aneignet und sie pflegt, erwirbt sich in Bezug auf den sittlichen Verfall der Massen eine geistige Immunität.“

        Diese jungen Leute tun mir sehr leid. Sie kennen doch nur diese eine Erziehung: linke Zucht. Und „links“ bedeutet „falsch herum“, eben: falsch!

  31. Fundstück:

    Das war so wichtig, dass ich es sofort herausholen wollte. Meine Recherchen in der NCBI-Datenbank für Nukleo-tidsequenzen haben zu einer verblüffenden Entdeckung geführt. Eine der WHO-Primersequenzen im PCR-Test für SARS-CoV-2 findet sich in der gesamten menschlichen DNA!

    Die Sequenz „CTCCCTTTTGTTTGTGTTTTTGT“ ist eine 18-stellige Primersequenz, die im Dokument des WHO-PCR-Testprotokolls für Coronaviren zu finden ist. Die Primersequenzen werden durch das PCR-Verfahren amplifiziert, um nachgewiesen und als „positives“ Testergebnis bezeichnet zu werden. Zufälligerweise findet sich genau diese 18-Zeichen-Sequenz wörtlich auch auf dem Homo sapiens-Chromosom 8! Soweit ich das beurteilen kann, bedeutet dies, dass die WHO-Testkits bei allen Menschen ein positives Ergebnis finden sollten. Kann das jemand anders erklären?

    Ich kann die Bedeutung dieses Ergebnisses wirklich nicht genug betonen. Zumindest sollte es einen nennenswerten Einfluss auf die Testergebnisse haben.

    Homo sapiens-Chromosom 8, GRCh38.p12 Primäre Versammlung
    Sequenz-ID: NC_00000008.11 Länge: 145138636
    Bereich 1: 63648346 bis 63648363 ist „CTCCCTTTGTTTGTGTTTTGT“.

    Update: Nach einiger Anstrengung habe ich endlich einen Weg gefunden, um (über meine Screenshots hinaus) den Beweis zu erbringen, dass das menschliche Chromosom 8 genau dieselbe 18-Zeichen-Sequenz aufweist. Bitte versuchen Sie den untenstehenden Link. Die Sequenz wird unten auf der Seite angezeigt.

    Übersetzt mit http://www.DeepL.com/Translator (kostenlose Version)

    Quelle: https://pieceofmindful.com/2020/04/06/bombshell-who-coronavirus-pcr-test-primer-sequence-is-found-in-all-human-dna/

    1. ZITAT @ Zitrone:
      „Soweit ich das beurteilen kann, bedeutet dies, dass die WHO-Testkits bei allen Menschen ein positives Ergebnis finden sollten. Kann das jemand anders erklären?“

      NEIN!

      Denn die Beobachtung der LÜGNER & ihrer LÜGEN bringt dem ausgebildeten Kriminalisten & Profiler Tag für Tag neue BEWEISE – daß der MEGA-BETRUG defakto ALLEN Beteiligen vollkommen BEWUSST ist – wir haben es also mit ORGANISIERTER KRIMINALITÄT auf höchster Ebene zu tun!

      DANKE @ Zitrone!

        1. @ Zitrone:
          Mein Dankeschön war als DANK für das SUCHEN, das FINDEN & für das POSTEN gedacht!

          Es ist doch toll – daß wir nicht ganz allein nach der Wahrheit suchen – sondern daß es sich lohnt, auch weit draußen in anderen Welten, nach EHRLICHEN Menschen zu suchen & ihre Beiträge verbreiten zu helfen.

          Dafür DANKE!

      1. @Kalle Möllemann
        @geneigte Leser

        Hier der der Knaller des Tages:

        „Schluß mit der Zettelwirtschaft! Endlich ist es möglich, sich online erfassen zu lassen.“
        (Nachrichtensprecher SWR von heute, 17 Uhr)

        Viel Spaß dabei! Ich gehe schnell in den Keller. Da lachen schon wieder welche …
        😂

    2. Gehen Sie auf die Seite Thetruthseeker.com. Der Artikel wurde auf der Seite veröffentlicht. Unter Kommentare finden Sie den Kommentator Analyser mit einer brillianten, zugegeben mit einer etwas längeren, Analyse dazu. Wenn Sie das gelesen haben wird die Brisanz klarer und auch immer gruseliger.

      Ich empfehle zusätzlich auf der gleichen Seite das Video von Dr. Carrie Madej. Diese hübsch anzusehende Ärztin ist kompetent und mit der Agenda vertraut. Kurzweilig und infomativ. Die Frontlinedoctors gehören zu den Guten.

      Und zum Schluss empfehle ich Ihnen noch die Seite Health Impact News, wo heute HCQ und die Thesen von Dr. Merryl Nass in einem längeren Artikel beschrieben wurden.

  32. Viele Einzelelemente beinhaltet das gegenwärtige Corona-Geschehen. Mir kommt langsam das Bild eines Puzzle-Spieles: Virus-Theorien & (RNA)Impfstoff & Corona-App & Maske & PCR-Test & & & …
    Alles das kann man einzeln betrachten – näher untersuchen – dabei mehr Fragen als Antworten finden – im besten Fall staunt man über den Unsinn der Auflagen und Massnahmen – oder ist erschüttert über die systematische Verlogenheit im Handeln und in der Kommunikation von Politikern und ihren „Zuarbeitern“.

    Ich frage mich, ob die Einzelmassnahmen nicht noch ein Geheimnis verbergen.
    Ein wichtiges – vielleicht sogar zentrales Puzzleteil tritt in der öffentlichen Diskussion weitgehend zurück: 5G !!
    Liegt bei 5G der Schlüssel zum Ganzen?

    Was ist der Effekt des Masken-tragens, ausser dass es ein Symbol der Unterwerfung unter staatlichen Terror darstellt?
     Masken behindern die Atmung ! Auch wenn das z.Zt. gerne wissenschftlich abgestritten wird, das Tragen einer Maske behindert das Atmen, man wird mit der Zeit ordentlich dummdösig.
    Man bedenke, dass in einigen Ländern schon das Tragen der Maske im Freien zur Auflage geworden ist…
     Auch bei der Corona-Erkrankung gibt es einen Zusammenhang mit der Atmung – weswegen Personen mit Erkrankung oder Schwäche der Lunge besonders gefährdet zu sein scheinen.

    UND NUN:  Was sind die Wirkungen von 5G auf den menschlichen Organismus? Dazu habe ich noch Fragen – stehe mit meiner Recherche noch am Anfang (und der Bereich ist mir bisher alles andere als vertraut)!
    Von David Icke gibt es die Aussage, dass 5G bei 60 GHz Frequenzen die Sauerstoffaufnahme ins Blut blockiert…
    (mit deutscher übersetzung zu finden unter „David Icke – Coronavirus: Hintergründe zum Covid-19 Shutdown!“)
    Sollte an dieser Aussage etwas dran sein, dann wären die weiteren Ausführungen von Icke bedenkenswert, nämlich dass das Corona-Virus von Wesentlichem ablenken soll, das uns in naher Zukunft als tödliche Folgeschäden beim geplanten flächendeckenden Einsatz der 5G-Technik droht. Das Corona-Virus wäre somit ein Fake – hinter dem die eigentliche, mit ähnlichen Symptomen erscheinende, von 5G ausgehende Gefahr verschleiert werden könnte.
    Die Beseitigung von Gefahren verhindert man am besten durch unsaubere Nachweiswege zur Ermittlung der Ursache. Das ist ja, was wir zur Zeit erleben: Ein heilloses Wirrwarr in der Kommunikation von Zahlen und Fakten zu den Themen Virus – Maske – PCR-Test …

    Auf einen Zusammenhang von Corona-Toten mit 5G-Ausstrahlungsorten weist auch Dr. Dietrich Klinghardt hin (in diversen Videos seit März 2020).
    Zu 5G waren mir va auch die links zu sehr informativen Beiträgen auf der Seite der Anwälte für Aufklärung eine Verständnishilfe:
    https://www.afa.zone/aktuelles/
    Bzw. speziell zu 5G:
    https://www.rechtsanwalt-wilfried-schmitz.de/corona-5g-und-voelkerstrafrecht/

    Was den PCR Test angeht, frage ich mich, was sich dahinter wohl für eine Absicht verbirgt. Dass der Test nix taugt zur Ermittlung von Corona-Infektionen, dürfte inzwischen hinreichend bekannt sein. Aber was – ausser der gewünschten Panikmache und dem zunehmend erschreckenden Quarantäne-Terror – könnte sich dahinter noch verbergen?

    1. Was sich dahinter verbirgt?

      Meine Vermutung ist, daß die „ewige Pandemie“ den permanenten Maskenzwang rechtfertigen soll. Durch die mangelnde Sauerstoffversorgung des Gehirns wegen der Maske leidet das Denkvermögen, die Menschen werden dadurch leichter erreichbar für Suggestionen, akzeptieren eher eine Impfung, die ihr Genom verändert und sterben später an unheilbaren Impfschäden.
      Solch ein Impfschaden könnte auch die Unfähigkeit zur Fortpflanzung sein!

      Auf diese Weise kann es schließlich möglich gemacht werden, diesen Planeten von Milliarden Menschen zu „befreien“ ohne auch nur einen einzigen Schuß abzugeben.

      Erscheint zwar auch mir äußerst dystopisch und dennoch ziemlich plausibel.

      1. Es gibt seit langem weit effektivere Einflüsse, die bewirken, dass Menschen leicht erreichbar sind für Suggestionen. Und vermutlich leidet die Sauerstoffversorgung des Gehirns weit mehr unter dem Einfluss von EMS. Wie sehr die Natur und menschliche Gesundheit bereits durch die Vorläufer von 5G beeinträchtigt sind, kann jeder schnell erfahren, wenn er will. Ich empfehle dazu die jüngsten Videos mit dem Naturheilkundler Dr. Klinghardt.
        Meine Frage zielte darauf ab, ob und wie (!) die Vorbereitungen der Einführung von 5G durch Corona samt Begleitwerk in Form von Masken-PCR… verdeckt werden. Wo liegt der Casus Knacksus – was und wie dient hier der Vertuschung???

        @ Till Aussenspiegel – Sie schreiben:
        „Auf diese Weise kann es schließlich möglich gemacht werden, diesen Planeten von Milliarden Menschen zu „befreien“ ohne auch nur einen einzigen Schuß abzugeben.“
        Das nun wiederum glaube ich nicht. Man kann doch annehmen, dass geschossen wird!
        Allerdings nicht mit althergebrachten Waffen, sondern mit EMS.
        5G ist eine Waffe !
        Und als solche soll und wird sie zweifelsfrei zum Einsatz kommen, wenn die flächendeckende Installation von Sendemasten (sofern noch möglich) nicht aufgehalten wird.
        Siehe nochmals:
        https://www.rechtsanwalt-wilfried-schmitz.de/corona-5g-und-voelkerstrafrecht/

  33. Danke Herr Ludwig, dass Sie den Kommentarstrang so lange offen halten, auch wenn das für Sie viel Arbeit ist. Es kommt so viel interessantes und weiterführendes zusammen, was ermuigt und zeigt, nicht alleine oder nur mit wenigen wachen Menschen dazustehen.

    1. Stimmt! Man könnte sonst verzweifeln.
      Vielen Dank darum an Herrn Ludwig für diesen geistreichen Blog!

    1. @ logos
      Danke für die links zu dem sehr informativen und aufschlussreichen Demo-Aufsatz!!
      Weitgehend kann ich folgen und zustimmen. Nur ist mir zu wenig Farbe im Bild – es ist zu krass schwarz-weiss gemalt. Auch wird durch die Lektüre die Zukunft für mein (zugegeben geschichtlich-politisches Minimal-Verständnis) nicht sichtbar.
      Es mag sich einiges ändern durch die US-Wahl und eine weitere Amtszeit von Trump, aber … mal schauen, ob es einen Friedensvertrag für Deutschland gibt??

    2. @logos Ich schließe mich dem Dank von Barbara Stoll an. Solange die Überwachungsssoftware von Herrn Ballweg mit der Zustimmung aller Beteiligten läuft, sehe ich darin nichts Unethisches. Wie die Veranstaltatungen finziert werden, darüber sollte Herr Ballweg auch mal Auskunft geben. Zugegeben, der Baphomet verblüfft strukturell mit dem Plakat des Meditierenden und der Friedenstaube auf dem Baumstamm bei der Demo in Augsburg. Mit Anselm Lenz trägt ein Würdiger das antifaschistische Logo auf dem T-Shirt. Ich denke er hat es absichtlich als ironischen Spaß getragen, um das Logo gwissermaßen heimzuholen, wo es hingehört.

      Um Himmels Willen, Ken Jebsen trägt auch mal einen Schachbrettschal;-)! Zahlen und Symbole spielen sicher bei den geheimen Logen eine Rolle. Unterwanderungen sind bei allen Parteien und politischen Bewegungen zu beobachten. Es ist auch nicht übermenschlich schwer, die Geister zu unterscheiden. Wenn das Böse sich als gut tarnt, scheinen üblicherweise auch die bösen Absichten durch. An den Früchten der Menschen lässt sich ihr Charakter ziemlich gut ablesen, Irrtümer natürlich nicht immer ausgeschlossen.

      Nun muss allerdings bald mehr Druck auf den Demos durch lautstärkere Sofortbeendigungen aller Grundrechtebeschränkungen erfolgen, sonst verliert die Strategie „Wir sind mehr“ an Durchschlagskraft. Der 29.08. wird mehr offenbaren. Loveparade gut und schön – ohne Konsequenzen geht es in Richtung Sedierungshappenings. Bei den Meistern der Durchsetzungsmaßnahmen von Unterdrückung jedenfalls keine Fragen, wessen Geistes Kinder sie sind. Auch noch mal besten Dank an Herrn Ludwig für seine Moderationsarbeit!

  34. Lebe nicht in Bayern, aber in der nächsten etwas größeren Stadt wurde meiner Information nach ein Grundschul-Kind mit ärztlichem Attest, dass es keine Maske tragen muss, nicht in die Schule gelassen. – Das Schultor wurde einfach geschlossen und das Kind soll weinend alleine vor der Schule gestanden haben, bis dann endlich seine Eltern informiert waren und es abholten.

    In derselben Stadt soll nach meiner Information eine ganze Schule geschlossen worden und zur Testung aller SchülerInnen beordert worden sein, weil ein einziges Kind wohl bei einer hausärztlichen Testung positiv getetest worden seine soll – inwieweit dieser Test dann zuverlässig war, dass sei dahingestellt – das ist wiederum eine andere aber dennoch mit dem gesamten Thema zusammenhängende Frage, wenn wir an die positiv getestete Papaya in Tansania denken.

    Diese Stadt muss ich dazu noch bemerken, ist politisch tiefrot.

    Also der grasierende Wahnsinn scheint wohl überall die abstrusesten und unmenschlichsten giftigsten Blüten zu treiben.

  35. Hallo Barbara, kurz vor dem Erscheinen der verlinkten Aufsätze sah ich zufällig ein Video von Kai aus Hannover – Querdenken – Demos: Eine kritische Analyse- der Mann scheint mir kein Schwätzer zu sein – der äusserte ähnliche Bedenken.
    Es kann nicht verkehrt sein, nicht blauäugig zu folgen, sondern selbst nachzudenken. Gerade in dieser Zeit, da alles auf dem Kopf zu stehen scheint. Woher kommt das Geld für Querdenken?
    Alles Spender? Skepsis ist meines Erachtens nicht unangebracht. Wie leicht es ist, arglose Menschen zu instrumentalisieren, weiß man zwischenzeitlich. Und genau diesen Umstand nutzen die Protagonisten. Einem normalen Mensch fällt es unheimlich schwer zu durchschauen. Unter dem Gesichtpunkt der gegenwärtigen Situation bekommt diese ominöse Deagel-Liste einen fast verständlichen Sinn.

    1. Guten Abend Logos – noch schnell zu später Stund:
      Ja – selbst nachdenken ist angesagt, spätestens jetzt kommt man nicht drum herum.
      Allerdings ist Austausch vonnöten, – dass brauchbare Informationen zusammengetragen werden.
      Dazu dient dieser Blog vorzüglich. Für die Beiträge von Herrn Ludwig – und für die zahlreichen Kommentare mit immer wieder wertvollen Hinweisen und Anregungen bin ich ausgesprochen dankbar. Das erlebe ich als einen rechten Gewinn der gegenwärtigen Krise.

  36. Thema: Wahlen (ob in Bayern oder im Rest Deutschlands).

    Ich möchte einmal aufräumen mit dem von nur wenigen, aber ganz bestimmten Kommentierenden (Kathrina nennt sie „Trolle“), entweder aus Unwissenheit oder mit böser Absicht ins Gespräch gebrachten Vorurteil, das Volk habe Schuld an der Misere, die uns ereilt hat. Dieses Vorurteil ist falsch. Wieder zeigt uns die Fassade etwas ganz anderes als die Wirklichkeit.

    Schon die Voraussetzung für dieses Vorurteil ist falsch. Es werden hier Volk und Wahlvolk in einen Topf geworfen, dabei werden wir weiter unten sehen, daß z.B. das Wahlvolk der Blockparteien weniger als die Hälfte ausmacht.

    Dann wird – wieder entweder aus Dummheit oder mit einer bösen Absicht – behauptet, im Nach-1945-Deutschland gäbe es für das Volk die Möglichkeit, Personen in die politischen Ämter zu wählen. Auch diese Aussage ist falsch. Immerhin konnte das Deutsche Volk während der Weimarer Republik den Reichspräsidenten wählen. Doch in der Nach-1945-Republik, der Bonner und Berliner Republik, geht das nicht. Seit 1949, als die Bundesrepublik Deutschland gegründet wurde, darf das Deutsche Volk den Bundespräsidenten NICHT wählen, obwohl dieser nur repräsentative Aufgaben (von den frühen Bundespräsidenten auch als Pflichten verstanden) hat. In der Bundesrepublik Deutschland darf das Volk nur Parteien wählen.

    Folgend möchte ich eine wahlpolitische „Bilanz“ vorstellen, wie man sie der Form nach auch aus der wirtschaftlichen Buchführung kennt. Berücksichtigt habe ich auf der Aktivseite („AKTIVA“) die Wähler der Blockparteien und der AfD (die noch keine Blockpartei ist, aber dabei ist, eine zu werden) und auf der Passivseite („PASSIVA“) werde ich diejenigen, die nicht wählen, nicht wählen dürfen und solche Parteien wählen, die wegen der 5%-Hürde sich nicht an der aktiven Politik beteiligt sein können (dieser Tatbestand ist übrigens genauso verfassungswidrig wie viele andere Tatsachen, die die Wahl betreffen), sondern sie passiv erleiden müssen.

    Die Zahlen beziehen sich auf die Bundestagswahl 2017:
    AKTIVA:
    ——-
    CDU/CSU (Blockpartei): 25,1
    SPD (Blockpartei): 15,6
    AfD: 9,6
    FDP (Blockpartei): 8,2
    Linke (Blockpartei): 7,0
    Grüne (Blockpartei): 6,8
    ———————-
    Zwischensumme: 72,3
    ———————-
    Summe: 72,3
    ———–

    PASSIVA:
    ——-
    Nichtwahlberechtigte als „Partei“: 27,4
    Nichtwähler als „Partei“: 23,8
    Unter-der-5%-Hürde-Parteien: 3,9
    ———————–
    Zwischensumme: 55,1
    Saldo (gegenüber der Aktivseite): 17,2
    ———————–
    Summe: 72,3
    ———–
    Hätte ich eine „Bilanz“ erstellt, die auf der Aktivseite nur die Blockparteien berücksichtigt hätte, dann wäre die Passivseite der Aktivseite überlegen. Aktiva: 62,7; Passiva: 64,7. Also 2 mehr auf der Passivseite! Das heißt: Die Blockparteien werden von nur 49,2 Prozent des Volkes gewählt. Wir sind ein Volk, bestehen also aus 100% und nicht aus „49,2 Prozent“ (Blockparteienwähler).

    Außerdem müssen für die falsche These, das Volk (die Trolle meinen damit fälschlicherweise die eben erwähnten 49,2 Prozent) wähle aus „Dummheit“ – eine dumme Behauptung (!) – zwei weitere Aspekte berücksichtigt werden, nämlich zum einen den Profit, auf den schon KW, zum anderen die Angst, auf die schon Kathrina hingewiesen hat.

    Profit. – Drei Viertel der Wähler der Blockparteien profitieren von ihrer Wahl – sie wählen also nicht aus Dummheit, sondern aus einem Kalkül und damit aus einer Intelligenz heraus. Auf das Volk bezogen heißt das, daß 36,9 Prozent des Volkes aus einer aus Profitinteresse erfolgten Berechnung heraus wählen.

    Angst. – Von den die Blockparteien wählenden 49,2 Prozent des Volkes bleiben nur noch 12,3 Prozent übrig, die entweder aus Angst oder aus Dummheit die Blockparteien wählen. Aber es geht ja noch weiter:

    Wie hoch die Prozentzahl derjenigen ist, die aus Angst wählen, weiß ich nicht (Kathrina würde wahrscheinlich sagen: „relativ hoch“). Ich veranschlage „nur“ 10 Prozent.

    Dummheit? – Aus Dummheit können nach dieser Berechnung höchstens 2,3 Prozent des Volkes die Blockparteien wählen, wobei hinzugefügt werden muß, daß diese Prozentzahl sehr wahrscheinlich sogar nach unten berichtigt werden muß, so daß das Ergebnis für die aus Dummheit die Blockparteien Wählenden wohl noch nicht einmal 0,1 Prozent des Volkes ist.

    Es kommt bei dem Thema hier auch gar nicht auf ein Promille mehr oder weniger, auch nicht auf ein Prozent mehr oder weniger, ja noch nicht einmal auf zehn Prozent mehr oder weniger an, sondern nur darauf, daß das eingangs erwähnte, aus Dummheit oder Böswilligkeit heraus erwähnte, trollige Vorurteil falsch ist.

    @ Kathrina ( https://fassadenkratzer.wordpress.com/2020/08/13/die-wahren-gruende-der-illegalen-migranten-aus-afrika/comment-page-1/#comment-16621)

    Recht haben Sie, Kathrina. Danke.

    1. @ Alf.

      Danke für das erneute Thematisieren der Wahlen, des Wahl- und Wählerbetrugs. Auch bei diesem Thema fällt auf, wie erfolgreich die falschen Aussagen und deren stumpfe Wiederholung durch die Medien sind. Sie bauen Lügengebäude, schmücken deren Fassaden, weil niemand die Wirklichkeit erkennen und die Wahrheit wissen soll.

      @ Till Außenspiegel:

      „Meine Vermutung ist, daß die »ewige Pandemie« den permanenten Maskenzwang rechtfertigen soll. Durch die mangelnde Sauerstoffversorgung des Gehirns wegen der Maske leidet das Denkvermögen, die Menschen werden dadurch leichter erreichbar für Suggestionen, akzeptieren eher eine Impfung, die ihr Genom verändert und sterben später an unheilbaren Impfschäden. Solch ein Impfschaden könnte auch die Unfähigkeit zur Fortpflanzung sein!

      Auf diese Weise kann es schließlich möglich gemacht werden, diesen Planeten von Milliarden Menschen zu »befreien« ohne auch nur einen einzigen Schuß abzugeben.

      Erscheint zwar auch mir äußerst dystopisch und dennoch ziemlich plausibel.“

      Und das ist auch plausibel. Stellen Sie sich einmal vor, Sie wären gerade erwachsen geworden und zuvor während ihrer gesamten Kindheit und gesamten Jugend mit einer Mund-und-Nasen-Maske herumgelaufen, hätten also ihre eigene ausgeatmete, sehr kohlendioxidreiche, dafür aber um so sauerstoffärmere Luft eingeatmet. Wir wissen, daß sehr mächtige Menschen, die kaum jemand kennt, die Bevölkerung reduzieren wollen und sie auch schon in Teilen der Welt (nicht zuletzt im Westen – Stichwort: Abtreibungspolitk) reduziert haben. Auch wissen wir, daß sie die Weltbevölkerung impfen wollen und nicht wenige Menschen bereits kaputtgeimpft haben, daß sie die Bevölkerungen in Kriege getrieben haben und weiterhin treiben werden, daß sie die Wirtschaft und unseren Planeten zerstören, weil sie geldgierig, geizig und rücksichtslos gegenüber anderen menschen, anderen Lebewesen, der ganzen Schöpfung sind.

      Habe ich etwas vergessen?

      Bringen Sie jetzt das alles zusammen, dann wird sofort klar, daß die Globalisten gar keine andere Wahl haben als die, die auf die globale Zerstörung, das „Große Chaos “, wie Volkmar Weiß jetzt sagen würde, schnurstracks zuläuft.

      Wunderte Sie das Ergebnis nun? Wohl kaum. Oder?

    2. Dank für Ihre umfangreiche Recherche. Dennoch – anzunehmen, dass lediglich 0,1 % der Wähler aus „Dummheit“ ( Gleichgültigkeit, Unwissen, Nichtwissenwollen …..sollten auch genannt werden) die genannten Blockparteien wählen, halte ich für unzutreffend. Aus eigener Beobachtung würde ich den Prozentsatz zumindest in meiner Umgebung , („Speckgürtel“ des Volkswagenwerkes) auf mind. 50% !!! schätzen. Umgeben von Menschen, deren Bewußtseinsausrichtung seit Generationen ausschließlich auf Erwerb und Erhalt von „materiellen Gütern“ ausgerichtet ist, denen offene Widersprüche gegen offizielle Darstellungen der politischen Situation bereits als revolutionärer Akt erscheint, die Dankbriefe für die (Zitat) „umsichtige und kluge Führung während der Coronakrise“an die politische Führung in Berlin senden, kann ich der Behauptung, dass jedes Volk die Regierung bekommt bzw. hat, die es verdient, eher zustimmen. Die genannte Region stellt m.M. nach ein Umfeld dar, aus dem jedes Regime die bereitwilligen Mitläufer und Apparatschiks rekrutiert, die es für seinen Erhalt benötigt. Ich denke, dass diese Region kein Einzelfall ist.

Kommentare sind geschlossen.